Incidental Mutation 'R7029:Nov'
ID546197
Institutional Source Beutler Lab
Gene Symbol Nov
Ensembl Gene ENSMUSG00000037362
Gene Namenephroblastoma overexpressed gene
SynonymsCCN3, C130088N23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R7029 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location54745702-54754039 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54747775 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 102 (D102G)
Ref Sequence ENSEMBL: ENSMUSP00000054389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050027]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050027
AA Change: D102G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054389
Gene: ENSMUSG00000037362
AA Change: D102G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IB 27 98 8.2e-34 SMART
VWC 104 167 6.08e-18 SMART
low complexity region 172 181 N/A INTRINSIC
TSP1 204 247 5.51e-7 SMART
CT 266 335 1.18e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a small secreted cysteine-rich protein and a member of the CCN family of regulatory proteins. CNN family proteins associate with the extracellular matrix and play an important role in cardiovascular and skeletal development, fibrosis and cancer development. [provided by RefSeq, Feb 2009]
PHENOTYPE: Heterozygotes and homozygotes for a null mutation exhibit abnormal skeletal and cardiac development, muscle atrophy and cataracts. Mice homozygous for another knock-out allele exhibit minor bone structure and physiology defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,343 Q271R probably benign Het
Abhd4 T A 14: 54,262,707 W63R probably damaging Het
Adcy5 A G 16: 35,299,648 M1176V probably null Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Brox G A 1: 183,284,186 P206L possibly damaging Het
Def6 A G 17: 28,225,969 K447R probably benign Het
Dna2 T C 10: 62,963,994 S726P probably damaging Het
Ell G A 8: 70,579,229 V15I probably damaging Het
Epha3 T A 16: 63,773,335 D130V probably benign Het
Fam189a1 T A 7: 64,759,327 T440S probably benign Het
Gm16486 G T 8: 70,708,862 V235L possibly damaging Het
Gys1 A G 7: 45,439,584 T200A possibly damaging Het
Habp4 A T 13: 64,162,125 H47L probably benign Het
Kcnj10 C A 1: 172,368,996 R26S probably benign Het
Klhl1 T A 14: 96,518,196 D41V probably benign Het
Lyn A G 4: 3,782,996 T410A probably damaging Het
Mga A G 2: 119,923,550 T847A probably damaging Het
Mrgpra3 G T 7: 47,589,542 T212N probably benign Het
Myh4 T C 11: 67,246,425 F491L probably benign Het
Neurl4 T A 11: 69,910,736 I1206N probably damaging Het
Pcdhb15 T A 18: 37,475,568 W618R possibly damaging Het
Pomc A G 12: 3,960,146 H129R probably damaging Het
Ppm1l C A 3: 69,553,066 H325Q probably benign Het
Psme4 A G 11: 30,772,474 probably benign Het
Reep2 A G 18: 34,845,289 I74V probably null Het
Robo2 T G 16: 73,948,337 E850A probably damaging Het
Scrn2 T A 11: 97,030,436 probably benign Het
Sfpq G A 4: 127,029,882 R673K probably benign Het
Sh2d3c T C 2: 32,754,569 *703R probably null Het
Spp1 A G 5: 104,439,301 M85V probably benign Het
Srebf1 T C 11: 60,206,984 E98G probably damaging Het
Srrm4 T A 5: 116,444,792 probably benign Het
Ticam1 A T 17: 56,271,154 S314T possibly damaging Het
Tie1 T C 4: 118,484,626 I209V possibly damaging Het
Vapa G A 17: 65,582,591 R194* probably null Het
Vcan C T 13: 89,690,241 D2395N probably damaging Het
Whamm A G 7: 81,591,826 H295R probably benign Het
Zdhhc14 A G 17: 5,647,911 Y85C probably damaging Het
Zfp35 T A 18: 24,003,526 F309Y probably damaging Het
Zfp423 C A 8: 87,688,066 C1187F probably damaging Het
Zfp874b T C 13: 67,474,273 Y302C probably damaging Het
Other mutations in Nov
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Nov APN 15 54749260 missense probably damaging 1.00
IGL01480:Nov APN 15 54752291 missense probably damaging 1.00
IGL01727:Nov APN 15 54746238 missense probably benign 0.17
IGL02027:Nov APN 15 54747934 missense probably damaging 0.98
IGL02690:Nov APN 15 54747802 missense probably damaging 1.00
IGL03089:Nov APN 15 54749284 missense possibly damaging 0.72
IGL03229:Nov APN 15 54749308 missense probably benign 0.19
R0556:Nov UTSW 15 54749167 missense probably damaging 1.00
R1162:Nov UTSW 15 54747782 nonsense probably null
R1321:Nov UTSW 15 54749246 missense probably damaging 1.00
R1572:Nov UTSW 15 54749252 missense possibly damaging 0.89
R1994:Nov UTSW 15 54749354 missense probably benign
R2151:Nov UTSW 15 54752458 missense probably benign 0.10
R4785:Nov UTSW 15 54752207 critical splice acceptor site probably null
R5165:Nov UTSW 15 54749189 missense probably damaging 1.00
R5577:Nov UTSW 15 54752501 missense possibly damaging 0.54
R6131:Nov UTSW 15 54749360 missense probably benign 0.28
R6307:Nov UTSW 15 54748025 critical splice donor site probably null
R6472:Nov UTSW 15 54749272 missense possibly damaging 0.95
R6557:Nov UTSW 15 54747927 nonsense probably null
R7000:Nov UTSW 15 54752347 missense probably damaging 1.00
R7957:Nov UTSW 15 54746338 missense possibly damaging 0.93
X0063:Nov UTSW 15 54746321 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TTCTGGAAGCAACCGCAAG -3'
(R):5'- TGGGTTTCTCACCTGGAAGG -3'

Sequencing Primer
(F):5'- CGCAAGGACTTATCTCTCTTTAAGAC -3'
(R):5'- GAGCCACAGGTCCACTTTTCG -3'
Posted On2019-05-13