Mutagenetix > Incidental Mutations

Incidental Mutation 'R7029:Epha3'

546199

Institutional Source

Beutler Lab

Gene Symbol

Epha3

Ensembl Gene

ENSMUSG00000052504

Gene Name

Eph receptor A3

Synonyms

Tyro4, End3, Cek4, Hek, Hek4, Mek4

MMRRC Submission

Accession Numbers

Genbank: NM_010140; MGI: 99612

Is this an essential gene?

Possibly non essential (E-score: 0.349) question?

Stock #

R7029 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

63543534-63864175 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 63773335 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 130 (D130V)

Ref Sequence

ENSEMBL: ENSMUSP00000066554 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064405] [ENSMUST00000231270] [ENSMUST00000232049] [ENSMUST00000232461] [ENSMUST00000232654]

Predicted Effect

probably benign
Transcript: ENSMUST00000064405
AA Change: D130V

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000066554
Gene: ENSMUSG00000052504
AA Change: D130V

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EPH_lbd	29	202	1.76e-127	SMART
Pfam:GCC2_GCC3	263	306	6.6e-9	PFAM
FN3	326	418	1.14e-5	SMART
FN3	437	518	4.8e-13	SMART
Pfam:EphA2_TM	543	619	8.2e-25	PFAM
TyrKc	622	879	5.16e-140	SMART
SAM	909	976	1.08e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000231270

Predicted Effect

probably benign
Transcript: ENSMUST00000232049
AA Change: D130V

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

probably benign
Transcript: ENSMUST00000232461

Predicted Effect

probably benign
Transcript: ENSMUST00000232654
AA Change: D130V

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene encodes a protein that binds ephrin-A ligands. Two alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die within 48 hours of birth of cardiac failure. Survivors develop normally with no indications of cardiac abnormalities. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Gene trapped(2)

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	T	C	6: 146,952,343	Q271R	probably benign	Het
Abhd4	T	A	14: 54,262,707	W63R	probably damaging	Het
Adcy5	A	G	16: 35,299,648	M1176V	probably null	Het
Bach1	G	A	16: 87,719,291	R240Q	probably benign	Het
Brox	G	A	1: 183,284,186	P206L	possibly damaging	Het
Def6	A	G	17: 28,225,969	K447R	probably benign	Het
Dna2	T	C	10: 62,963,994	S726P	probably damaging	Het
Ell	G	A	8: 70,579,229	V15I	probably damaging	Het
Fam189a1	T	A	7: 64,759,327	T440S	probably benign	Het
Gm16486	G	T	8: 70,708,862	V235L	possibly damaging	Het
Gys1	A	G	7: 45,439,584	T200A	possibly damaging	Het
Habp4	A	T	13: 64,162,125	H47L	probably benign	Het
Kcnj10	C	A	1: 172,368,996	R26S	probably benign	Het
Klhl1	T	A	14: 96,518,196	D41V	probably benign	Het
Lyn	A	G	4: 3,782,996	T410A	probably damaging	Het
Mga	A	G	2: 119,923,550	T847A	probably damaging	Het
Mrgpra3	G	T	7: 47,589,542	T212N	probably benign	Het
Myh4	T	C	11: 67,246,425	F491L	probably benign	Het
Neurl4	T	A	11: 69,910,736	I1206N	probably damaging	Het
Nov	A	G	15: 54,747,775	D102G	possibly damaging	Het
Pcdhb15	T	A	18: 37,475,568	W618R	possibly damaging	Het
Pomc	A	G	12: 3,960,146	H129R	probably damaging	Het
Ppm1l	C	A	3: 69,553,066	H325Q	probably benign	Het
Psme4	A	G	11: 30,772,474		probably benign	Het
Reep2	A	G	18: 34,845,289	I74V	probably null	Het
Robo2	T	G	16: 73,948,337	E850A	probably damaging	Het
Scrn2	T	A	11: 97,030,436		probably benign	Het
Sfpq	G	A	4: 127,029,882	R673K	probably benign	Het
Sh2d3c	T	C	2: 32,754,569	*703R	probably null	Het
Spp1	A	G	5: 104,439,301	M85V	probably benign	Het
Srebf1	T	C	11: 60,206,984	E98G	probably damaging	Het
Srrm4	T	A	5: 116,444,792		probably benign	Het
Ticam1	A	T	17: 56,271,154	S314T	possibly damaging	Het
Tie1	T	C	4: 118,484,626	I209V	possibly damaging	Het
Vapa	G	A	17: 65,582,591	R194*	probably null	Het
Vcan	C	T	13: 89,690,241	D2395N	probably damaging	Het
Whamm	A	G	7: 81,591,826	H295R	probably benign	Het
Zdhhc14	A	G	17: 5,647,911	Y85C	probably damaging	Het
Zfp35	T	A	18: 24,003,526	F309Y	probably damaging	Het
Zfp423	C	A	8: 87,688,066	C1187F	probably damaging	Het
Zfp874b	T	C	13: 67,474,273	Y302C	probably damaging	Het

Other mutations in Epha3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00773:Epha3	APN	16	63566684	missense	probably damaging	1.00
IGL01358:Epha3	APN	16	63595746	splice site	probably benign
IGL01713:Epha3	APN	16	63552562	missense	probably benign	0.00
IGL02371:Epha3	APN	16	63585020	critical splice acceptor site	probably null
IGL03111:Epha3	APN	16	63653446	missense	probably damaging	0.98
IGL03208:Epha3	APN	16	63611089	missense	probably damaging	1.00
laterality	UTSW	16	63568399	missense	probably damaging	1.00
midline	UTSW	16	63844144	missense	possibly damaging	0.46
stride	UTSW	16	63552494	missense	probably benign	0.00
F2404:Epha3	UTSW	16	63546168	missense	probably benign	0.14
P0041:Epha3	UTSW	16	63612868	missense	probably damaging	1.00
PIT4498001:Epha3	UTSW	16	63552526	missense	probably damaging	1.00
PIT4585001:Epha3	UTSW	16	63566577	critical splice donor site	probably null
R0147:Epha3	UTSW	16	63612944	missense	possibly damaging	0.89
R0148:Epha3	UTSW	16	63612944	missense	possibly damaging	0.89
R0336:Epha3	UTSW	16	63566648	missense	probably damaging	1.00
R0738:Epha3	UTSW	16	63595612	missense	probably damaging	1.00
R0833:Epha3	UTSW	16	63603519	splice site	probably benign
R0836:Epha3	UTSW	16	63603519	splice site	probably benign
R0969:Epha3	UTSW	16	63566636	missense	probably damaging	1.00
R1160:Epha3	UTSW	16	63773068	missense	probably damaging	1.00
R1205:Epha3	UTSW	16	63598248	frame shift	probably null
R1349:Epha3	UTSW	16	63611053	missense	possibly damaging	0.89
R1372:Epha3	UTSW	16	63611053	missense	possibly damaging	0.89
R1469:Epha3	UTSW	16	63653494	missense	probably damaging	0.97
R1469:Epha3	UTSW	16	63653494	missense	probably damaging	0.97
R1500:Epha3	UTSW	16	63595662	missense	probably benign	0.06
R1523:Epha3	UTSW	16	63610948	missense	probably damaging	0.99
R1532:Epha3	UTSW	16	63546178	missense	probably benign	0.08
R1544:Epha3	UTSW	16	63773053	missense	probably damaging	1.00
R1681:Epha3	UTSW	16	63595728	missense	probably damaging	1.00
R1708:Epha3	UTSW	16	63583507	missense	probably damaging	1.00
R1803:Epha3	UTSW	16	63602288	missense	probably benign	0.00
R1893:Epha3	UTSW	16	63568399	missense	probably damaging	1.00
R1957:Epha3	UTSW	16	63772952	missense	probably benign	0.00
R2144:Epha3	UTSW	16	63773317	missense	possibly damaging	0.86
R2190:Epha3	UTSW	16	63546189	missense	probably benign	0.05
R2198:Epha3	UTSW	16	63844144	missense	possibly damaging	0.46
R2344:Epha3	UTSW	16	63652383	missense	possibly damaging	0.67
R2504:Epha3	UTSW	16	63603625	missense	probably damaging	0.97
R2911:Epha3	UTSW	16	63652412	missense	probably benign
R3889:Epha3	UTSW	16	63610964	missense	probably damaging	1.00
R4223:Epha3	UTSW	16	63583539	missense	probably damaging	0.99
R4836:Epha3	UTSW	16	63583557	missense	probably damaging	1.00
R4981:Epha3	UTSW	16	63652412	missense	probably benign	0.04
R5044:Epha3	UTSW	16	63602287	missense	possibly damaging	0.79
R5195:Epha3	UTSW	16	63546147	missense	possibly damaging	0.86
R5248:Epha3	UTSW	16	63598257	missense	probably damaging	1.00
R5478:Epha3	UTSW	16	63583533	missense	probably damaging	1.00
R6052:Epha3	UTSW	16	63603604	missense	possibly damaging	0.94
R6167:Epha3	UTSW	16	63612924	missense	probably benign	0.00
R6337:Epha3	UTSW	16	63568443	missense	probably damaging	1.00
R6342:Epha3	UTSW	16	63583500	missense	probably damaging	1.00
R6793:Epha3	UTSW	16	63773455	missense	probably benign	0.01
R6908:Epha3	UTSW	16	63598249	missense	probably damaging	1.00
R7059:Epha3	UTSW	16	63568455	missense	probably damaging	1.00
R7175:Epha3	UTSW	16	63583500	missense	probably damaging	1.00
R7204:Epha3	UTSW	16	63652332	missense	probably benign
R7217:Epha3	UTSW	16	63552494	missense	probably benign	0.00
R7315:Epha3	UTSW	16	63552609	missense	probably benign	0.00
R7389:Epha3	UTSW	16	63772984	missense	probably damaging	1.00
R7419:Epha3	UTSW	16	63598294	missense	probably damaging	1.00
R7572:Epha3	UTSW	16	63611080	nonsense	probably null
R7667:Epha3	UTSW	16	63566600	missense	probably benign	0.21
R7686:Epha3	UTSW	16	63773288	missense	probably damaging	1.00
R7855:Epha3	UTSW	16	63773560	missense	probably damaging	1.00
R7938:Epha3	UTSW	16	63773560	missense	probably damaging	1.00
Z1176:Epha3	UTSW	16	63585012	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTCTTCACTGTAAACGGGCAC -3'
(R):5'- TGCAATGTCATGGATCACAGC -3'

Sequencing Primer
(F):5'- CGGGCACTTTTTGAAGTACAC -3'
(R):5'- GTCATGGATCACAGCCAAAATAATTG -3'

Posted On

2019-05-13