Incidental Mutation 'R7029:Reep2'
ID 546207
Institutional Source Beutler Lab
Gene Symbol Reep2
Ensembl Gene ENSMUSG00000038555
Gene Name receptor accessory protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock # R7029 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 34840589-34847463 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34845289 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 74 (I74V)
Ref Sequence ENSEMBL: ENSMUSP00000036065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043484]
AlphaFold Q8VCD6
Predicted Effect probably null
Transcript: ENSMUST00000043484
AA Change: I74V

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000036065
Gene: ENSMUSG00000038555
AA Change: I74V

DomainStartEndE-ValueType
Pfam:TB2_DP1_HVA22 7 95 1.4e-36 PFAM
low complexity region 129 138 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor expression enhancing protein family. Studies of a related gene in mouse suggest that the encoded protein is found in the cell membrane and enhances the function of sweet taste receptors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,343 Q271R probably benign Het
Abhd4 T A 14: 54,262,707 W63R probably damaging Het
Adcy5 A G 16: 35,299,648 M1176V probably null Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Brox G A 1: 183,284,186 P206L possibly damaging Het
Def6 A G 17: 28,225,969 K447R probably benign Het
Dna2 T C 10: 62,963,994 S726P probably damaging Het
Ell G A 8: 70,579,229 V15I probably damaging Het
Epha3 T A 16: 63,773,335 D130V probably benign Het
Fam189a1 T A 7: 64,759,327 T440S probably benign Het
Gm16486 G T 8: 70,708,862 V235L possibly damaging Het
Gys1 A G 7: 45,439,584 T200A possibly damaging Het
Habp4 A T 13: 64,162,125 H47L probably benign Het
Kcnj10 C A 1: 172,368,996 R26S probably benign Het
Klhl1 T A 14: 96,518,196 D41V probably benign Het
Lyn A G 4: 3,782,996 T410A probably damaging Het
Mga A G 2: 119,923,550 T847A probably damaging Het
Mrgpra3 G T 7: 47,589,542 T212N probably benign Het
Myh4 T C 11: 67,246,425 F491L probably benign Het
Neurl4 T A 11: 69,910,736 I1206N probably damaging Het
Nov A G 15: 54,747,775 D102G possibly damaging Het
Pcdhb15 T A 18: 37,475,568 W618R possibly damaging Het
Pomc A G 12: 3,960,146 H129R probably damaging Het
Ppm1l C A 3: 69,553,066 H325Q probably benign Het
Psme4 A G 11: 30,772,474 probably benign Het
Robo2 T G 16: 73,948,337 E850A probably damaging Het
Scrn2 T A 11: 97,030,436 probably benign Het
Sfpq G A 4: 127,029,882 R673K probably benign Het
Sh2d3c T C 2: 32,754,569 *703R probably null Het
Spp1 A G 5: 104,439,301 M85V probably benign Het
Srebf1 T C 11: 60,206,984 E98G probably damaging Het
Srrm4 T A 5: 116,444,792 probably benign Het
Ticam1 A T 17: 56,271,154 S314T possibly damaging Het
Tie1 T C 4: 118,484,626 I209V possibly damaging Het
Vapa G A 17: 65,582,591 R194* probably null Het
Vcan C T 13: 89,690,241 D2395N probably damaging Het
Whamm A G 7: 81,591,826 H295R probably benign Het
Zdhhc14 A G 17: 5,647,911 Y85C probably damaging Het
Zfp35 T A 18: 24,003,526 F309Y probably damaging Het
Zfp423 C A 8: 87,688,066 C1187F probably damaging Het
Zfp874b T C 13: 67,474,273 Y302C probably damaging Het
Other mutations in Reep2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01716:Reep2 APN 18 34846249 missense probably benign
IGL02244:Reep2 APN 18 34840754 unclassified probably benign
R0624:Reep2 UTSW 18 34840771 missense probably benign 0.02
R2005:Reep2 UTSW 18 34845621 missense probably damaging 1.00
R2910:Reep2 UTSW 18 34845690 critical splice donor site probably null
R2911:Reep2 UTSW 18 34845690 critical splice donor site probably null
R5642:Reep2 UTSW 18 34846218 missense probably benign
R6709:Reep2 UTSW 18 34846210 missense probably benign 0.10
R8327:Reep2 UTSW 18 34842513 missense probably damaging 0.98
R8944:Reep2 UTSW 18 34842876 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CCTTCCGCATGAGTCAGTTTTG -3'
(R):5'- TGGCCACCCATAGGAAATATCTG -3'

Sequencing Primer
(F):5'- ATGAGTCAGTTTTGTGTTCCCAAC -3'
(R):5'- CACCCATAGGAAATATCTGTGGCTG -3'
Posted On 2019-05-13