Mutagenetix > Incidental Mutations

Incidental Mutation 'R7030:Chrna4'

546222

Institutional Source

Beutler Lab

Gene Symbol

Chrna4

Ensembl Gene

ENSMUSG00000027577

Gene Name

cholinergic receptor, nicotinic, alpha polypeptide 4

Synonyms

alpha4 nAChR, Acra-4, a4 nicotinic receptor, Acra4, alpha4-nAChR

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.162) question?

Stock #

R7030 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

181018380-181043546 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 181029541 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 141 (T141A)

Ref Sequence

ENSEMBL: ENSMUSP00000104479 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067120] [ENSMUST00000108851] [ENSMUST00000124400]

Predicted Effect

probably damaging
Transcript: ENSMUST00000067120
AA Change: T141A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000066338
Gene: ENSMUSG00000027577
AA Change: T141A

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Pfam:Neur_chan_LBD	39	245	1.4e-76	PFAM
Pfam:Neur_chan_memb	252	620	1.9e-107	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000108851
AA Change: T141A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000104479
Gene: ENSMUSG00000027577
AA Change: T141A

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Pfam:Neur_chan_LBD	39	245	8.4e-79	PFAM
Pfam:Neur_chan_memb	252	620	3.3e-112	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000124400

SMART Domains

Protein: ENSMUSP00000123043
Gene: ENSMUSG00000027577

Domain	Start	End	E-Value	Type
Pfam:Neur_chan_LBD	22	78	3.6e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000198922

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (92/94)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nicotinic acetylcholine receptor, which belongs to a superfamily of ligand-gated ion channels that play a role in fast signal transmission at synapses. These pentameric receptors can bind acetylcholine, which causes an extensive change in conformation that leads to the opening of an ion-conducting channel across the plasma membrane. This protein is an integral membrane receptor subunit that can interact with either nAChR beta-2 or nAChR beta-4 to form a functional receptor. Mutations in this gene cause nocturnal frontal lobe epilepsy type 1. Polymorphisms in this gene that provide protection against nicotine addiction have been described. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
PHENOTYPE: Nullizygous mice may show reduced chemically-elicited analgesia, susceptibility to seizures, increased anxiety, and altered behavioral responses to nicotine or a new environment. Homozygotes for any of several knock-in alleles exhibit altered nervous system physiology and/or sensitivity to nicotine. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abr	A	T	11: 76,459,212	I347N	probably damaging	Het
Acbd4	T	A	11: 103,104,159	L50Q	probably damaging	Het
Acsl5	T	G	19: 55,272,819	Y69*	probably null	Het
Agtpbp1	G	A	13: 59,504,294	T401I	probably damaging	Het
Ap3m2	C	T	8: 22,799,791	E99K	probably damaging	Het
Arhgef28	A	T	13: 97,988,261	S504R	possibly damaging	Het
Arsj	T	A	3: 126,439,103	D499E	probably damaging	Het
Bach1	G	A	16: 87,719,291	R240Q	probably benign	Het
Camk2b	T	C	11: 5,989,575	D232G	probably damaging	Het
Casc3	C	T	11: 98,822,533	P258S	possibly damaging	Het
Catspere2	T	A	1: 178,017,714	I100N	probably damaging	Het
Ccdc80	T	A	16: 45,122,889	N787K	possibly damaging	Het
Celsr1	C	A	15: 85,905,478	C2653F	probably damaging	Het
Cep170	T	C	1: 176,756,485	E11G	probably damaging	Het
Chia1	A	C	3: 106,115,325	N12H	probably damaging	Het
Col25a1	T	C	3: 130,479,022		probably null	Het
Dcstamp	A	T	15: 39,759,533	I417F	probably damaging	Het
Dnah5	A	G	15: 28,238,592	I427V	probably benign	Het
Dnah5	A	G	15: 28,333,062	E2203G	probably benign	Het
Dnmt3c	A	T	2: 153,717,425	S409C	probably damaging	Het
Dock6	A	T	9: 21,813,079	M1541K	probably damaging	Het
Dzip1l	C	T	9: 99,665,835	T714I	probably benign	Het
Exoc6b	T	C	6: 84,848,825	R535G	probably damaging	Het
Fam196b	T	A	11: 34,402,030	V24E	probably damaging	Het
Fam83h	A	G	15: 76,004,739	S250P	probably benign	Het
Fat4	C	T	3: 38,981,958	T3253I	probably damaging	Het
Fer1l6	T	A	15: 58,629,378	F1302I	probably damaging	Het
Fmnl1	T	G	11: 103,194,774		probably benign	Het
Gckr	C	A	5: 31,302,210	F201L	possibly damaging	Het
Gm10036	A	G	18: 15,833,235	T148A	probably benign	Het
Gm13178	G	T	4: 144,703,603	A272D	possibly damaging	Het
Gm5142	G	A	14: 59,178,460	S83F	probably benign	Het
Gm8765	G	T	13: 50,702,983	V886L	possibly damaging	Het
Gpr37	A	T	6: 25,689,005	V31D	possibly damaging	Het
Gramd3	A	T	18: 56,485,249	Y207F	probably damaging	Het
Hr	T	C	14: 70,563,684		probably null	Het
Igf2r	A	G	17: 12,733,866	L231P	probably damaging	Het
Ighv1-66	A	T	12: 115,593,537	W3R	probably damaging	Het
Kcnu1	T	C	8: 25,918,463	S101P	probably benign	Het
Klhl23	T	G	2: 69,833,966	V553G	probably damaging	Het
Lrp1	T	C	10: 127,552,876	I3235V	probably damaging	Het
Mb	A	T	15: 77,016,056	I57N	probably damaging	Het
Micu1	T	C	10: 59,789,021	I295T	possibly damaging	Het
Mink1	G	A	11: 70,607,775	V589I	possibly damaging	Het
Mndal	T	C	1: 173,875,594	K82E	probably damaging	Het
Mroh1	A	C	15: 76,437,317	K1066T	probably benign	Het
Muc5b	T	A	7: 141,842,455	N149K	unknown	Het
Myo7b	G	T	18: 31,971,573	L1404I	probably damaging	Het
Nlrc4	A	G	17: 74,446,006	S461P	probably damaging	Het
Nudt12	A	T	17: 59,003,353	D418E	probably benign	Het
Olfr130	T	A	17: 38,068,057	D295E	probably benign	Het
Olfr996	G	T	2: 85,579,402	R54S	possibly damaging	Het
Pcdha1	A	G	18: 37,159,273	H817R	probably damaging	Het
Pcdha4	A	G	18: 36,954,027	Y421C	probably damaging	Het
Pcf11	T	C	7: 92,657,678	D1094G	probably benign	Het
Pck2	A	T	14: 55,547,766	D427V	probably damaging	Het
Pclo	A	G	5: 14,676,407	T1760A	probably benign	Het
Pdzk1ip1	T	A	4: 115,092,991	Y83N	probably damaging	Het
Pgs1	T	C	11: 118,002,486	I213T	probably damaging	Het
Plin4	T	A	17: 56,103,969	T1021S	probably damaging	Het
Plxnb1	T	A	9: 109,112,307	I1677N	probably damaging	Het
Pm20d2	T	C	4: 33,174,752	E378G	possibly damaging	Het
Prkcq	T	G	2: 11,226,850		probably null	Het
Psmd2	C	T	16: 20,662,133	P780L	probably damaging	Het
Pvr	A	G	7: 19,905,180	S392P	possibly damaging	Het
Rad51ap2	G	C	12: 11,457,431	L451F	possibly damaging	Het
Rbm20	A	G	19: 53,834,766	E598G	probably damaging	Het
Rho	A	T	6: 115,935,543	N123Y	possibly damaging	Het
Rictor	T	C	15: 6,708,453		probably null	Het
Rilpl2	T	G	5: 124,468,593	K186T	probably damaging	Het
Rps6ka4	A	C	19: 6,839,624	L61R	probably damaging	Het
Sds	C	A	5: 120,480,825	Q118K	probably benign	Het
Sept1	C	T	7: 127,216,985	R91K	probably benign	Het
Sf3a3	A	G	4: 124,722,880	Y185C	probably damaging	Het
Shtn1	T	C	19: 59,009,834	M376V	possibly damaging	Het
Slc6a9	A	G	4: 117,857,436	T189A	possibly damaging	Het
Slc7a6	T	G	8: 106,195,974	V464G	possibly damaging	Het
Smg8	T	A	11: 87,085,093	D554V	probably damaging	Het
Sox8	A	G	17: 25,570,108		probably null	Het
Spats2l	T	A	1: 57,879,530	V41D	probably damaging	Het
Sult2a3	A	T	7: 14,067,568	F282Y	probably damaging	Het
Svs3a	T	G	2: 164,290,171	Y220D	probably damaging	Het
Teddm1a	T	A	1: 153,892,623	Y278N	probably damaging	Het
Tlk1	T	C	2: 70,721,928	Y526C	probably damaging	Het
Tmc3	T	A	7: 83,616,817		probably null	Het
Ttn	T	A	2: 76,766,239	E20110V	probably damaging	Het
Tulp4	A	G	17: 6,214,666	D235G	probably damaging	Het
Usp50	T	C	2: 126,780,475	Y55C	possibly damaging	Het
Vmn1r224	T	C	17: 20,419,527	L122P	probably benign	Het
Vmn2r62	A	G	7: 42,789,049	L121P	possibly damaging	Het
Whrn	G	T	4: 63,495,131		probably benign	Het
Zer1	G	T	2: 30,111,021	H129Q	probably benign	Het
Zfand4	G	A	6: 116,305,657	A64T	probably benign	Het

Other mutations in Chrna4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00815:Chrna4	APN	2	181029391	missense	probably benign	0.09
IGL00914:Chrna4	APN	2	181029031	missense	probably damaging	1.00
IGL01511:Chrna4	APN	2	181028668	missense	probably benign	0.13
IGL02517:Chrna4	APN	2	181029133	missense	probably benign	0.01
IGL02715:Chrna4	APN	2	181029581	unclassified	probably benign
R1168:Chrna4	UTSW	2	181034138	missense	possibly damaging	0.61
R1475:Chrna4	UTSW	2	181029379	missense	probably benign	0.44
R1572:Chrna4	UTSW	2	181029307	missense	possibly damaging	0.95
R4428:Chrna4	UTSW	2	181028620	missense	probably damaging	0.99
R4429:Chrna4	UTSW	2	181028620	missense	probably damaging	0.99
R4431:Chrna4	UTSW	2	181028620	missense	probably damaging	0.99
R4494:Chrna4	UTSW	2	181028488	missense	probably damaging	0.98
R4664:Chrna4	UTSW	2	181037493	missense	probably damaging	1.00
R4666:Chrna4	UTSW	2	181037493	missense	probably damaging	1.00
R4931:Chrna4	UTSW	2	181028872	missense	probably benign	0.00
R5144:Chrna4	UTSW	2	181024830	missense	probably damaging	1.00
R5556:Chrna4	UTSW	2	181033980	missense	possibly damaging	0.94
R5633:Chrna4	UTSW	2	181029460	missense	probably damaging	1.00
R5889:Chrna4	UTSW	2	181028658	missense	probably damaging	1.00
R6056:Chrna4	UTSW	2	181029442	missense	probably damaging	1.00
R6120:Chrna4	UTSW	2	181024806	missense	probably damaging	1.00
R7352:Chrna4	UTSW	2	181037474	missense	probably damaging	0.97
R7694:Chrna4	UTSW	2	181018593	missense

Predicted Primers

PCR Primer
(F):5'- AAGTCCAGTTGGTCCACACG -3'
(R):5'- CTGAAGTGCACAGGTGAGTGAC -3'

Sequencing Primer
(F):5'- GGCTGTGCATGCTCACCAAG -3'
(R):5'- TGACGGCCCAGTCCACATG -3'

Posted On

2019-05-13