Incidental Mutation 'R7030:Casc3'
ID 546259
Institutional Source Beutler Lab
Gene Symbol Casc3
Ensembl Gene ENSMUSG00000078676
Gene Name exon junction complex subunit
Synonyms Mln51, Btz
MMRRC Submission 045131-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.946) question?
Stock # R7030 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 98700634-98724633 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 98713359 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 258 (P258S)
Ref Sequence ENSEMBL: ENSMUSP00000130926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017384] [ENSMUST00000169695]
AlphaFold Q8K3W3
Predicted Effect possibly damaging
Transcript: ENSMUST00000017384
AA Change: P258S

PolyPhen 2 Score 0.743 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000017384
Gene: ENSMUSG00000078676
AA Change: P258S

DomainStartEndE-ValueType
low complexity region 18 62 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
low complexity region 89 109 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Btz 138 246 1.02e-57 SMART
low complexity region 524 533 N/A INTRINSIC
low complexity region 586 614 N/A INTRINSIC
low complexity region 627 648 N/A INTRINSIC
low complexity region 669 684 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169695
AA Change: P258S

PolyPhen 2 Score 0.743 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000130926
Gene: ENSMUSG00000078676
AA Change: P258S

DomainStartEndE-ValueType
low complexity region 18 62 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
low complexity region 89 109 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Btz 138 246 1.02e-57 SMART
low complexity region 524 533 N/A INTRINSIC
low complexity region 586 614 N/A INTRINSIC
low complexity region 627 648 N/A INTRINSIC
low complexity region 669 684 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a core component of the exon junction complex (EJC), a protein complex that is deposited on spliced mRNAs at exon-exon junctions and functions in nonsense-mediated mRNA decay (NMD). The encoded protein binds RNA and interacts with two other EJC core components. It is predominantly located in the cytoplasm, but shuttles into the nucleus where it localizes to nuclear speckles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygosity for a null or hypomorphic allele causes embryonic and postnatal lethality, respectively. Compound heterozygous embryos are smaller and exhibit proportionately reduced brain size with fewer neurons and progenitors, but no apoptosis, largely due to developmental delay. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AAdacl4fm3 G T 4: 144,430,173 (GRCm39) A272D possibly damaging Het
Abr A T 11: 76,350,038 (GRCm39) I347N probably damaging Het
Acbd4 T A 11: 102,994,985 (GRCm39) L50Q probably damaging Het
Acsl5 T G 19: 55,261,251 (GRCm39) Y69* probably null Het
Agtpbp1 G A 13: 59,652,108 (GRCm39) T401I probably damaging Het
Ap3m2 C T 8: 23,289,807 (GRCm39) E99K probably damaging Het
Arhgef28 A T 13: 98,124,769 (GRCm39) S504R possibly damaging Het
Arsj T A 3: 126,232,752 (GRCm39) D499E probably damaging Het
Bach1 G A 16: 87,516,179 (GRCm39) R240Q probably benign Het
Camk2b T C 11: 5,939,575 (GRCm39) D232G probably damaging Het
Catspere2 T A 1: 177,845,280 (GRCm39) I100N probably damaging Het
Ccdc80 T A 16: 44,943,252 (GRCm39) N787K possibly damaging Het
Celsr1 C A 15: 85,789,679 (GRCm39) C2653F probably damaging Het
Cep170 T C 1: 176,584,051 (GRCm39) E11G probably damaging Het
Chia1 A C 3: 106,022,641 (GRCm39) N12H probably damaging Het
Chrna4 T C 2: 180,671,334 (GRCm39) T141A probably damaging Het
Col25a1 T C 3: 130,272,671 (GRCm39) probably null Het
Dcstamp A T 15: 39,622,929 (GRCm39) I417F probably damaging Het
Dnah5 A G 15: 28,238,738 (GRCm39) I427V probably benign Het
Dnah5 A G 15: 28,333,208 (GRCm39) E2203G probably benign Het
Dnmt3c A T 2: 153,559,345 (GRCm39) S409C probably damaging Het
Dock6 A T 9: 21,724,375 (GRCm39) M1541K probably damaging Het
Dzip1l C T 9: 99,547,888 (GRCm39) T714I probably benign Het
Exoc6b T C 6: 84,825,807 (GRCm39) R535G probably damaging Het
Fam83h A G 15: 75,876,588 (GRCm39) S250P probably benign Het
Fat4 C T 3: 39,036,107 (GRCm39) T3253I probably damaging Het
Fer1l6 T A 15: 58,501,227 (GRCm39) F1302I probably damaging Het
Fmnl1 T G 11: 103,085,600 (GRCm39) probably benign Het
Gckr C A 5: 31,459,554 (GRCm39) F201L possibly damaging Het
Gm10036 A G 18: 15,966,292 (GRCm39) T148A probably benign Het
Gm5142 G A 14: 59,415,909 (GRCm39) S83F probably benign Het
Gpr37 A T 6: 25,689,004 (GRCm39) V31D possibly damaging Het
Gramd2b A T 18: 56,618,321 (GRCm39) Y207F probably damaging Het
Hr T C 14: 70,801,124 (GRCm39) probably null Het
Igf2r A G 17: 12,952,753 (GRCm39) L231P probably damaging Het
Ighv1-66 A T 12: 115,557,157 (GRCm39) W3R probably damaging Het
Insyn2b T A 11: 34,352,030 (GRCm39) V24E probably damaging Het
Kcnu1 T C 8: 26,408,491 (GRCm39) S101P probably benign Het
Klhl23 T G 2: 69,664,310 (GRCm39) V553G probably damaging Het
Lrp1 T C 10: 127,388,745 (GRCm39) I3235V probably damaging Het
Mb A T 15: 76,900,256 (GRCm39) I57N probably damaging Het
Micu1 T C 10: 59,624,843 (GRCm39) I295T possibly damaging Het
Mink1 G A 11: 70,498,601 (GRCm39) V589I possibly damaging Het
Mndal T C 1: 173,703,160 (GRCm39) K82E probably damaging Het
Mroh1 A C 15: 76,321,517 (GRCm39) K1066T probably benign Het
Muc5b T A 7: 141,396,192 (GRCm39) N149K unknown Het
Myo7b G T 18: 32,104,626 (GRCm39) L1404I probably damaging Het
Nlrc4 A G 17: 74,753,001 (GRCm39) S461P probably damaging Het
Nudt12 A T 17: 59,310,348 (GRCm39) D418E probably benign Het
Or2g7 T A 17: 38,378,948 (GRCm39) D295E probably benign Het
Or5g27 G T 2: 85,409,746 (GRCm39) R54S possibly damaging Het
Pcdha1 A G 18: 37,292,326 (GRCm39) H817R probably damaging Het
Pcdha4 A G 18: 37,087,080 (GRCm39) Y421C probably damaging Het
Pcf11 T C 7: 92,306,886 (GRCm39) D1094G probably benign Het
Pck2 A T 14: 55,785,223 (GRCm39) D427V probably damaging Het
Pclo A G 5: 14,726,421 (GRCm39) T1760A probably benign Het
Pdzk1ip1 T A 4: 114,950,188 (GRCm39) Y83N probably damaging Het
Pgs1 T C 11: 117,893,312 (GRCm39) I213T probably damaging Het
Plin4 T A 17: 56,410,969 (GRCm39) T1021S probably damaging Het
Plxnb1 T A 9: 108,941,375 (GRCm39) I1677N probably damaging Het
Pm20d2 T C 4: 33,174,752 (GRCm39) E378G possibly damaging Het
Prkcq T G 2: 11,231,661 (GRCm39) probably null Het
Psmd2 C T 16: 20,480,883 (GRCm39) P780L probably damaging Het
Pvr A G 7: 19,639,105 (GRCm39) S392P possibly damaging Het
Rad51ap2 G C 12: 11,507,432 (GRCm39) L451F possibly damaging Het
Rbm20 A G 19: 53,823,197 (GRCm39) E598G probably damaging Het
Rho A T 6: 115,912,504 (GRCm39) N123Y possibly damaging Het
Rictor T C 15: 6,737,934 (GRCm39) probably null Het
Rilpl2 T G 5: 124,606,656 (GRCm39) K186T probably damaging Het
Rps6ka4 A C 19: 6,816,992 (GRCm39) L61R probably damaging Het
Sds C A 5: 120,618,890 (GRCm39) Q118K probably benign Het
Septin1 C T 7: 126,816,157 (GRCm39) R91K probably benign Het
Sf3a3 A G 4: 124,616,673 (GRCm39) Y185C probably damaging Het
Shtn1 T C 19: 58,998,266 (GRCm39) M376V possibly damaging Het
Slc6a9 A G 4: 117,714,633 (GRCm39) T189A possibly damaging Het
Slc7a6 T G 8: 106,922,606 (GRCm39) V464G possibly damaging Het
Smg8 T A 11: 86,975,919 (GRCm39) D554V probably damaging Het
Sox8 A G 17: 25,789,082 (GRCm39) probably null Het
Spata31e4 G T 13: 50,857,019 (GRCm39) V886L possibly damaging Het
Spats2l T A 1: 57,918,689 (GRCm39) V41D probably damaging Het
Sult2a3 A T 7: 13,801,493 (GRCm39) F282Y probably damaging Het
Svs3a T G 2: 164,132,091 (GRCm39) Y220D probably damaging Het
Teddm1a T A 1: 153,768,369 (GRCm39) Y278N probably damaging Het
Tlk1 T C 2: 70,552,272 (GRCm39) Y526C probably damaging Het
Tmc3 T A 7: 83,266,025 (GRCm39) probably null Het
Ttn T A 2: 76,596,583 (GRCm39) E20110V probably damaging Het
Tulp4 A G 17: 6,264,941 (GRCm39) D235G probably damaging Het
Usp50 T C 2: 126,622,395 (GRCm39) Y55C possibly damaging Het
Vmn1r224 T C 17: 20,639,789 (GRCm39) L122P probably benign Het
Vmn2r62 A G 7: 42,438,473 (GRCm39) L121P possibly damaging Het
Whrn G T 4: 63,413,368 (GRCm39) probably benign Het
Zer1 G T 2: 30,001,033 (GRCm39) H129Q probably benign Het
Zfand4 G A 6: 116,282,618 (GRCm39) A64T probably benign Het
Other mutations in Casc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Casc3 APN 11 98,714,028 (GRCm39) missense possibly damaging 0.62
IGL01566:Casc3 APN 11 98,714,227 (GRCm39) critical splice donor site probably null
IGL01901:Casc3 APN 11 98,713,947 (GRCm39) missense probably damaging 1.00
IGL02345:Casc3 APN 11 98,718,390 (GRCm39) splice site probably benign
IGL02875:Casc3 APN 11 98,712,378 (GRCm39) missense probably damaging 1.00
IGL02964:Casc3 APN 11 98,719,749 (GRCm39) missense probably damaging 0.96
R0147:Casc3 UTSW 11 98,713,325 (GRCm39) missense possibly damaging 0.89
R0195:Casc3 UTSW 11 98,712,319 (GRCm39) missense probably damaging 0.99
R0763:Casc3 UTSW 11 98,722,144 (GRCm39) missense probably damaging 1.00
R1581:Casc3 UTSW 11 98,713,644 (GRCm39) missense possibly damaging 0.66
R2021:Casc3 UTSW 11 98,712,332 (GRCm39) missense probably benign 0.01
R4380:Casc3 UTSW 11 98,713,857 (GRCm39) missense possibly damaging 0.67
R4612:Casc3 UTSW 11 98,713,784 (GRCm39) missense probably benign 0.13
R4988:Casc3 UTSW 11 98,712,700 (GRCm39) splice site probably null
R5079:Casc3 UTSW 11 98,701,252 (GRCm39) intron probably benign
R5442:Casc3 UTSW 11 98,712,297 (GRCm39) missense probably damaging 0.99
R5511:Casc3 UTSW 11 98,701,740 (GRCm39) nonsense probably null
R5873:Casc3 UTSW 11 98,712,270 (GRCm39) missense unknown
R6041:Casc3 UTSW 11 98,719,385 (GRCm39) missense probably damaging 1.00
R6685:Casc3 UTSW 11 98,713,356 (GRCm39) missense probably damaging 0.99
R7107:Casc3 UTSW 11 98,718,413 (GRCm39) missense possibly damaging 0.93
R7594:Casc3 UTSW 11 98,712,311 (GRCm39) missense probably benign 0.04
R7659:Casc3 UTSW 11 98,700,699 (GRCm39) missense unknown
R7660:Casc3 UTSW 11 98,700,699 (GRCm39) missense unknown
R8443:Casc3 UTSW 11 98,713,607 (GRCm39) missense probably damaging 1.00
R8444:Casc3 UTSW 11 98,713,607 (GRCm39) missense probably damaging 1.00
R8491:Casc3 UTSW 11 98,713,977 (GRCm39) missense probably benign 0.27
R8516:Casc3 UTSW 11 98,713,607 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTGCTTGGTTTGGTCCAGAC -3'
(R):5'- TCTCTTTGTGGGGAACTTCC -3'

Sequencing Primer
(F):5'- TCCAGACCCAAGGGACG -3'
(R):5'- CTTTGTGGGGAACTTCCAAATC -3'
Posted On 2019-05-13