Incidental Mutation 'R7030:Hr'
ID546270
Institutional Source Beutler Lab
Gene Symbol Hr
Ensembl Gene ENSMUSG00000022096
Gene Namehairless
SynonymsALUNC, AU, N, ba, bldy, hr, rh, rh-bmh, rhino
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7030 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location70552212-70573548 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 70563684 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022691] [ENSMUST00000161069] [ENSMUST00000163060]
Predicted Effect probably null
Transcript: ENSMUST00000022691
SMART Domains Protein: ENSMUSP00000022691
Gene: ENSMUSG00000022096

DomainStartEndE-ValueType
Blast:JmjC 54 849 N/A BLAST
JmjC 939 1150 5.23e-38 SMART
Predicted Effect probably null
Transcript: ENSMUST00000161069
SMART Domains Protein: ENSMUSP00000124816
Gene: ENSMUSG00000022096

DomainStartEndE-ValueType
Blast:JmjC 54 849 N/A BLAST
JmjC 939 1150 5.23e-38 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163060
SMART Domains Protein: ENSMUSP00000124042
Gene: ENSMUSG00000022096

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Blast:JmjC 83 878 N/A BLAST
JmjC 968 1179 5.23e-38 SMART
Meta Mutation Damage Score 0.514 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in hair growth. This protein functions as a transcriptional corepressor of multiple nuclear receptors, including thyroid hormone receptor, the retinoic acid receptor-related orphan receptors and the vitamin D receptors, and it interacts with histone deacetylases. The translation of this protein is modulated by a regulatory ORF that exists upstream of the primary ORF. Mutations in this upstream ORF, U2HR, cause Marie Unna hereditary hypotrichosis (MUHH), an autosomal dominant form of genetic hair loss in human. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mutant homozygotes exhibit hair loss, usually wrinkled skin with epidermal cysts. Females do not nurse their pups well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr A T 11: 76,459,212 I347N probably damaging Het
Acbd4 T A 11: 103,104,159 L50Q probably damaging Het
Acsl5 T G 19: 55,272,819 Y69* probably null Het
Agtpbp1 G A 13: 59,504,294 T401I probably damaging Het
Ap3m2 C T 8: 22,799,791 E99K probably damaging Het
Arhgef28 A T 13: 97,988,261 S504R possibly damaging Het
Arsj T A 3: 126,439,103 D499E probably damaging Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Camk2b T C 11: 5,989,575 D232G probably damaging Het
Casc3 C T 11: 98,822,533 P258S possibly damaging Het
Catspere2 T A 1: 178,017,714 I100N probably damaging Het
Ccdc80 T A 16: 45,122,889 N787K possibly damaging Het
Celsr1 C A 15: 85,905,478 C2653F probably damaging Het
Cep170 T C 1: 176,756,485 E11G probably damaging Het
Chia1 A C 3: 106,115,325 N12H probably damaging Het
Chrna4 T C 2: 181,029,541 T141A probably damaging Het
Col25a1 T C 3: 130,479,022 probably null Het
Dcstamp A T 15: 39,759,533 I417F probably damaging Het
Dnah5 A G 15: 28,238,592 I427V probably benign Het
Dnah5 A G 15: 28,333,062 E2203G probably benign Het
Dnmt3c A T 2: 153,717,425 S409C probably damaging Het
Dock6 A T 9: 21,813,079 M1541K probably damaging Het
Dzip1l C T 9: 99,665,835 T714I probably benign Het
Exoc6b T C 6: 84,848,825 R535G probably damaging Het
Fam196b T A 11: 34,402,030 V24E probably damaging Het
Fam83h A G 15: 76,004,739 S250P probably benign Het
Fat4 C T 3: 38,981,958 T3253I probably damaging Het
Fer1l6 T A 15: 58,629,378 F1302I probably damaging Het
Fmnl1 T G 11: 103,194,774 probably benign Het
Gckr C A 5: 31,302,210 F201L possibly damaging Het
Gm10036 A G 18: 15,833,235 T148A probably benign Het
Gm13178 G T 4: 144,703,603 A272D possibly damaging Het
Gm5142 G A 14: 59,178,460 S83F probably benign Het
Gm8765 G T 13: 50,702,983 V886L possibly damaging Het
Gpr37 A T 6: 25,689,005 V31D possibly damaging Het
Gramd3 A T 18: 56,485,249 Y207F probably damaging Het
Igf2r A G 17: 12,733,866 L231P probably damaging Het
Ighv1-66 A T 12: 115,593,537 W3R probably damaging Het
Kcnu1 T C 8: 25,918,463 S101P probably benign Het
Klhl23 T G 2: 69,833,966 V553G probably damaging Het
Lrp1 T C 10: 127,552,876 I3235V probably damaging Het
Mb A T 15: 77,016,056 I57N probably damaging Het
Micu1 T C 10: 59,789,021 I295T possibly damaging Het
Mink1 G A 11: 70,607,775 V589I possibly damaging Het
Mndal T C 1: 173,875,594 K82E probably damaging Het
Mroh1 A C 15: 76,437,317 K1066T probably benign Het
Muc5b T A 7: 141,842,455 N149K unknown Het
Myo7b G T 18: 31,971,573 L1404I probably damaging Het
Nlrc4 A G 17: 74,446,006 S461P probably damaging Het
Nudt12 A T 17: 59,003,353 D418E probably benign Het
Olfr130 T A 17: 38,068,057 D295E probably benign Het
Olfr996 G T 2: 85,579,402 R54S possibly damaging Het
Pcdha1 A G 18: 37,159,273 H817R probably damaging Het
Pcdha4 A G 18: 36,954,027 Y421C probably damaging Het
Pcf11 T C 7: 92,657,678 D1094G probably benign Het
Pck2 A T 14: 55,547,766 D427V probably damaging Het
Pclo A G 5: 14,676,407 T1760A probably benign Het
Pdzk1ip1 T A 4: 115,092,991 Y83N probably damaging Het
Pgs1 T C 11: 118,002,486 I213T probably damaging Het
Plin4 T A 17: 56,103,969 T1021S probably damaging Het
Plxnb1 T A 9: 109,112,307 I1677N probably damaging Het
Pm20d2 T C 4: 33,174,752 E378G possibly damaging Het
Prkcq T G 2: 11,226,850 probably null Het
Psmd2 C T 16: 20,662,133 P780L probably damaging Het
Pvr A G 7: 19,905,180 S392P possibly damaging Het
Rad51ap2 G C 12: 11,457,431 L451F possibly damaging Het
Rbm20 A G 19: 53,834,766 E598G probably damaging Het
Rho A T 6: 115,935,543 N123Y possibly damaging Het
Rictor T C 15: 6,708,453 probably null Het
Rilpl2 T G 5: 124,468,593 K186T probably damaging Het
Rps6ka4 A C 19: 6,839,624 L61R probably damaging Het
Sds C A 5: 120,480,825 Q118K probably benign Het
Sept1 C T 7: 127,216,985 R91K probably benign Het
Sf3a3 A G 4: 124,722,880 Y185C probably damaging Het
Shtn1 T C 19: 59,009,834 M376V possibly damaging Het
Slc6a9 A G 4: 117,857,436 T189A possibly damaging Het
Slc7a6 T G 8: 106,195,974 V464G possibly damaging Het
Smg8 T A 11: 87,085,093 D554V probably damaging Het
Sox8 A G 17: 25,570,108 probably null Het
Spats2l T A 1: 57,879,530 V41D probably damaging Het
Sult2a3 A T 7: 14,067,568 F282Y probably damaging Het
Svs3a T G 2: 164,290,171 Y220D probably damaging Het
Teddm1a T A 1: 153,892,623 Y278N probably damaging Het
Tlk1 T C 2: 70,721,928 Y526C probably damaging Het
Tmc3 T A 7: 83,616,817 probably null Het
Ttn T A 2: 76,766,239 E20110V probably damaging Het
Tulp4 A G 17: 6,214,666 D235G probably damaging Het
Usp50 T C 2: 126,780,475 Y55C possibly damaging Het
Vmn1r224 T C 17: 20,419,527 L122P probably benign Het
Vmn2r62 A G 7: 42,789,049 L121P possibly damaging Het
Whrn G T 4: 63,495,131 probably benign Het
Zer1 G T 2: 30,111,021 H129Q probably benign Het
Zfand4 G A 6: 116,305,657 A64T probably benign Het
Other mutations in Hr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01805:Hr APN 14 70565297 splice site probably benign
IGL02020:Hr APN 14 70556437 missense probably benign 0.01
IGL02372:Hr APN 14 70558350 missense possibly damaging 0.94
IGL02380:Hr APN 14 70557761 missense probably damaging 0.98
IGL02554:Hr APN 14 70559866 splice site probably benign
IGL02949:Hr APN 14 70559785 missense possibly damaging 0.87
IGL03406:Hr APN 14 70563420 critical splice donor site probably null
angie UTSW 14 70567833 missense probably damaging 0.97
blofeld UTSW 14 70568085 missense probably damaging 1.00
general UTSW 14 70563684 critical splice donor site probably null
kaburo UTSW 14 unclassified
mister_clean UTSW 14 70560065 critical splice donor site probably benign
mushroom UTSW 14 70568085 missense probably damaging 1.00
prune UTSW 14 70571429 missense probably damaging 1.00
ren UTSW 14 70568085 missense probably damaging 1.00
subclinical UTSW 14 70561836 missense possibly damaging 0.89
yuanxiao UTSW 14 70571448 missense probably damaging 1.00
R0018:Hr UTSW 14 70558277 missense probably benign
R0038:Hr UTSW 14 70568085 missense probably damaging 1.00
R0374:Hr UTSW 14 70556476 missense probably benign 0.01
R0511:Hr UTSW 14 70561912 nonsense probably null
R0609:Hr UTSW 14 70559657 missense probably benign
R1828:Hr UTSW 14 70572037 critical splice donor site probably null
R2030:Hr UTSW 14 70571448 missense probably damaging 1.00
R2266:Hr UTSW 14 70558107 missense probably benign
R2267:Hr UTSW 14 70558107 missense probably benign
R2268:Hr UTSW 14 70558107 missense probably benign
R2377:Hr UTSW 14 70557878 missense probably damaging 1.00
R3686:Hr UTSW 14 70557796 missense probably damaging 0.98
R3687:Hr UTSW 14 70557796 missense probably damaging 0.98
R3754:Hr UTSW 14 70567824 missense probably damaging 1.00
R3803:Hr UTSW 14 70557893 missense probably benign 0.01
R3846:Hr UTSW 14 70571453 missense probably damaging 1.00
R3977:Hr UTSW 14 70563584 missense probably benign 0.01
R3978:Hr UTSW 14 70563584 missense probably benign 0.01
R3979:Hr UTSW 14 70563584 missense probably benign 0.01
R4528:Hr UTSW 14 70566383 missense probably damaging 1.00
R4654:Hr UTSW 14 70563573 missense probably damaging 0.99
R4834:Hr UTSW 14 70559922 missense probably damaging 0.98
R4847:Hr UTSW 14 70556476 missense probably benign 0.04
R4863:Hr UTSW 14 70571972 missense probably damaging 1.00
R5292:Hr UTSW 14 70571992 missense probably damaging 1.00
R5452:Hr UTSW 14 70556627 missense probably damaging 1.00
R5717:Hr UTSW 14 70566176 missense probably benign 0.34
R5902:Hr UTSW 14 70557791 missense probably benign 0.02
R6000:Hr UTSW 14 70567833 missense probably damaging 0.97
R6439:Hr UTSW 14 70561836 missense possibly damaging 0.89
R6823:Hr UTSW 14 70565374 missense probably damaging 0.98
R7213:Hr UTSW 14 70558350 missense probably damaging 0.99
R7452:Hr UTSW 14 70571486 missense probably damaging 1.00
R7468:Hr UTSW 14 70558212 missense possibly damaging 0.89
X0025:Hr UTSW 14 70566951 splice site probably null
X0026:Hr UTSW 14 70567841 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCCTGACCCTGGTGACATG -3'
(R):5'- TGTTAAGTGCCTGCCAGGTG -3'

Sequencing Primer
(F):5'- ACATGGCTGTCTGGTTGG -3'
(R):5'- TGCCAGGTGCCTGAGATAC -3'
Posted On2019-05-13