Mutagenetix > Incidental Mutation

Incidental Mutation 'R7030:Igf2r'

546284

Institutional Source

Beutler Lab

Gene Symbol

Igf2r

Ensembl Gene

ENSMUSG00000023830

Gene Name

insulin-like growth factor 2 receptor

Synonyms

M6P/IGF2R, IGF-II/CI-MPR, Mpr300, CI-MPR, CD222, mannose-6-phosphate receptor, cation independent

MMRRC Submission

045131-MU

Accession Numbers

Genbank: NM_010515.2; Ensembl: ENSMUST00000024599, ENSMUST00000162982, ENSMUST00000159127

Essential gene?

Probably essential (E-score: 0.875) question?

Stock #

R7030 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12682406-12769664 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 12733866 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 231 (L231P)

Ref Sequence

ENSEMBL: ENSMUSP00000024599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024599]

AlphaFold

Q07113

Predicted Effect

probably damaging
Transcript: ENSMUST00000024599
AA Change: L231P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: L231P

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
Pfam:CIMR	118	266	5.1e-21	PFAM
Pfam:CIMR	272	416	8.8e-22	PFAM
Pfam:CIMR	418	567	3.4e-53	PFAM
Pfam:CIMR	569	709	6.5e-47	PFAM
Pfam:CIMR	713	869	6.5e-34	PFAM
Pfam:CIMR	876	1020	1.9e-10	PFAM
Pfam:CIMR	1024	1171	1e-60	PFAM
Pfam:CIMR	1172	1313	1.2e-17	PFAM
Pfam:CIMR	1315	1455	2.1e-58	PFAM
Pfam:CIMR	1458	1592	1.8e-22	PFAM
Pfam:CIMR	1596	1743	9.1e-23	PFAM
Pfam:CIMR	1748	1887	2.5e-22	PFAM
FN2	1889	1935	9.51e-26	SMART
Pfam:CIMR	1939	2076	2.1e-22	PFAM
Pfam:CIMR	2230	2294	4.9e-9	PFAM
transmembrane domain	2295	2317	N/A	INTRINSIC
low complexity region	2336	2363	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (92/94)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abr	A	T	11: 76,459,212	I347N	probably damaging	Het
Acbd4	T	A	11: 103,104,159	L50Q	probably damaging	Het
Acsl5	T	G	19: 55,272,819	Y69*	probably null	Het
Agtpbp1	G	A	13: 59,504,294	T401I	probably damaging	Het
Ap3m2	C	T	8: 22,799,791	E99K	probably damaging	Het
Arhgef28	A	T	13: 97,988,261	S504R	possibly damaging	Het
Arsj	T	A	3: 126,439,103	D499E	probably damaging	Het
Bach1	G	A	16: 87,719,291	R240Q	probably benign	Het
Camk2b	T	C	11: 5,989,575	D232G	probably damaging	Het
Casc3	C	T	11: 98,822,533	P258S	possibly damaging	Het
Catspere2	T	A	1: 178,017,714	I100N	probably damaging	Het
Ccdc80	T	A	16: 45,122,889	N787K	possibly damaging	Het
Celsr1	C	A	15: 85,905,478	C2653F	probably damaging	Het
Cep170	T	C	1: 176,756,485	E11G	probably damaging	Het
Chia1	A	C	3: 106,115,325	N12H	probably damaging	Het
Chrna4	T	C	2: 181,029,541	T141A	probably damaging	Het
Col25a1	T	C	3: 130,479,022		probably null	Het
Dcstamp	A	T	15: 39,759,533	I417F	probably damaging	Het
Dnah5	A	G	15: 28,238,592	I427V	probably benign	Het
Dnah5	A	G	15: 28,333,062	E2203G	probably benign	Het
Dnmt3c	A	T	2: 153,717,425	S409C	probably damaging	Het
Dock6	A	T	9: 21,813,079	M1541K	probably damaging	Het
Dzip1l	C	T	9: 99,665,835	T714I	probably benign	Het
Exoc6b	T	C	6: 84,848,825	R535G	probably damaging	Het
Fam196b	T	A	11: 34,402,030	V24E	probably damaging	Het
Fam83h	A	G	15: 76,004,739	S250P	probably benign	Het
Fat4	C	T	3: 38,981,958	T3253I	probably damaging	Het
Fer1l6	T	A	15: 58,629,378	F1302I	probably damaging	Het
Fmnl1	T	G	11: 103,194,774		probably benign	Het
Gckr	C	A	5: 31,302,210	F201L	possibly damaging	Het
Gm10036	A	G	18: 15,833,235	T148A	probably benign	Het
Gm13178	G	T	4: 144,703,603	A272D	possibly damaging	Het
Gm5142	G	A	14: 59,178,460	S83F	probably benign	Het
Gm8765	G	T	13: 50,702,983	V886L	possibly damaging	Het
Gpr37	A	T	6: 25,689,005	V31D	possibly damaging	Het
Gramd3	A	T	18: 56,485,249	Y207F	probably damaging	Het
Hr	T	C	14: 70,563,684		probably null	Het
Ighv1-66	A	T	12: 115,593,537	W3R	probably damaging	Het
Kcnu1	T	C	8: 25,918,463	S101P	probably benign	Het
Klhl23	T	G	2: 69,833,966	V553G	probably damaging	Het
Lrp1	T	C	10: 127,552,876	I3235V	probably damaging	Het
Mb	A	T	15: 77,016,056	I57N	probably damaging	Het
Micu1	T	C	10: 59,789,021	I295T	possibly damaging	Het
Mink1	G	A	11: 70,607,775	V589I	possibly damaging	Het
Mndal	T	C	1: 173,875,594	K82E	probably damaging	Het
Mroh1	A	C	15: 76,437,317	K1066T	probably benign	Het
Muc5b	T	A	7: 141,842,455	N149K	unknown	Het
Myo7b	G	T	18: 31,971,573	L1404I	probably damaging	Het
Nlrc4	A	G	17: 74,446,006	S461P	probably damaging	Het
Nudt12	A	T	17: 59,003,353	D418E	probably benign	Het
Olfr130	T	A	17: 38,068,057	D295E	probably benign	Het
Olfr996	G	T	2: 85,579,402	R54S	possibly damaging	Het
Pcdha1	A	G	18: 37,159,273	H817R	probably damaging	Het
Pcdha4	A	G	18: 36,954,027	Y421C	probably damaging	Het
Pcf11	T	C	7: 92,657,678	D1094G	probably benign	Het
Pck2	A	T	14: 55,547,766	D427V	probably damaging	Het
Pclo	A	G	5: 14,676,407	T1760A	probably benign	Het
Pdzk1ip1	T	A	4: 115,092,991	Y83N	probably damaging	Het
Pgs1	T	C	11: 118,002,486	I213T	probably damaging	Het
Plin4	T	A	17: 56,103,969	T1021S	probably damaging	Het
Plxnb1	T	A	9: 109,112,307	I1677N	probably damaging	Het
Pm20d2	T	C	4: 33,174,752	E378G	possibly damaging	Het
Prkcq	T	G	2: 11,226,850		probably null	Het
Psmd2	C	T	16: 20,662,133	P780L	probably damaging	Het
Pvr	A	G	7: 19,905,180	S392P	possibly damaging	Het
Rad51ap2	G	C	12: 11,457,431	L451F	possibly damaging	Het
Rbm20	A	G	19: 53,834,766	E598G	probably damaging	Het
Rho	A	T	6: 115,935,543	N123Y	possibly damaging	Het
Rictor	T	C	15: 6,708,453		probably null	Het
Rilpl2	T	G	5: 124,468,593	K186T	probably damaging	Het
Rps6ka4	A	C	19: 6,839,624	L61R	probably damaging	Het
Sds	C	A	5: 120,480,825	Q118K	probably benign	Het
Sept1	C	T	7: 127,216,985	R91K	probably benign	Het
Sf3a3	A	G	4: 124,722,880	Y185C	probably damaging	Het
Shtn1	T	C	19: 59,009,834	M376V	possibly damaging	Het
Slc6a9	A	G	4: 117,857,436	T189A	possibly damaging	Het
Slc7a6	T	G	8: 106,195,974	V464G	possibly damaging	Het
Smg8	T	A	11: 87,085,093	D554V	probably damaging	Het
Sox8	A	G	17: 25,570,108		probably null	Het
Spats2l	T	A	1: 57,879,530	V41D	probably damaging	Het
Sult2a3	A	T	7: 14,067,568	F282Y	probably damaging	Het
Svs3a	T	G	2: 164,290,171	Y220D	probably damaging	Het
Teddm1a	T	A	1: 153,892,623	Y278N	probably damaging	Het
Tlk1	T	C	2: 70,721,928	Y526C	probably damaging	Het
Tmc3	T	A	7: 83,616,817		probably null	Het
Ttn	T	A	2: 76,766,239	E20110V	probably damaging	Het
Tulp4	A	G	17: 6,214,666	D235G	probably damaging	Het
Usp50	T	C	2: 126,780,475	Y55C	possibly damaging	Het
Vmn1r224	T	C	17: 20,419,527	L122P	probably benign	Het
Vmn2r62	A	G	7: 42,789,049	L121P	possibly damaging	Het
Whrn	G	T	4: 63,495,131		probably benign	Het
Zer1	G	T	2: 30,111,021	H129Q	probably benign	Het
Zfand4	G	A	6: 116,305,657	A64T	probably benign	Het

Other mutations in Igf2r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Igf2r	APN	17	12713990	missense	probably benign	0.01
IGL00534:Igf2r	APN	17	12739328	missense	probably damaging	0.97
IGL00902:Igf2r	APN	17	12700358	missense	probably damaging	0.99
IGL00903:Igf2r	APN	17	12683867	missense	possibly damaging	0.70
IGL01160:Igf2r	APN	17	12704775	missense	possibly damaging	0.73
IGL01380:Igf2r	APN	17	12695374	missense	probably benign	0.01
IGL01392:Igf2r	APN	17	12704349	missense	probably benign
IGL01557:Igf2r	APN	17	12704635	missense	possibly damaging	0.82
IGL01568:Igf2r	APN	17	12683985	missense	possibly damaging	0.93
IGL01611:Igf2r	APN	17	12725415	nonsense	probably null
IGL01720:Igf2r	APN	17	12701313	missense	probably damaging	0.99
IGL01756:Igf2r	APN	17	12683822	missense	probably benign
IGL01839:Igf2r	APN	17	12705022	missense	probably damaging	1.00
IGL01904:Igf2r	APN	17	12714911	missense	probably damaging	0.99
IGL01965:Igf2r	APN	17	12704338	missense	probably benign	0.12
IGL02083:Igf2r	APN	17	12693192	nonsense	probably null
IGL02095:Igf2r	APN	17	12702005	missense	probably damaging	0.99
IGL02183:Igf2r	APN	17	12698516	unclassified	probably benign
IGL02576:Igf2r	APN	17	12748763	missense	possibly damaging	0.90
IGL02649:Igf2r	APN	17	12712087	missense	possibly damaging	0.93
IGL02807:Igf2r	APN	17	12719883	missense	probably damaging	0.98
IGL02833:Igf2r	APN	17	12692723	missense	probably damaging	0.97
IGL02885:Igf2r	APN	17	12694120	missense	possibly damaging	0.94
IGL02990:Igf2r	APN	17	12710746	splice site	probably benign
IGL03080:Igf2r	APN	17	12726676	missense	probably benign	0.06
IGL03176:Igf2r	APN	17	12716672	missense	probably damaging	1.00
blunt	UTSW	17	12722175	missense	probably benign	0.02
brusque	UTSW	17	12714951	missense	probably damaging	0.98
gruff	UTSW	17	12684097	missense	probably damaging	0.96
outlier	UTSW	17	12695314	missense	probably benign	0.20
NA:Igf2r	UTSW	17	12691962	missense	probably benign
R0165:Igf2r	UTSW	17	12698527	missense	probably benign	0.07
R0412:Igf2r	UTSW	17	12683948	missense	probably damaging	0.98
R0523:Igf2r	UTSW	17	12692064	missense	probably benign	0.27
R0631:Igf2r	UTSW	17	12717274	splice site	probably null
R0722:Igf2r	UTSW	17	12715495	critical splice acceptor site	probably null
R0894:Igf2r	UTSW	17	12692101	missense	probably benign	0.02
R1265:Igf2r	UTSW	17	12694124	missense	probably damaging	0.98
R1466:Igf2r	UTSW	17	12717269	splice site	probably benign
R1485:Igf2r	UTSW	17	12691285	missense	probably damaging	1.00
R1633:Igf2r	UTSW	17	12726309	missense	probably benign
R1693:Igf2r	UTSW	17	12704316	missense	probably damaging	0.97
R1751:Igf2r	UTSW	17	12697441	missense	possibly damaging	0.94
R1843:Igf2r	UTSW	17	12704270	critical splice donor site	probably null
R1981:Igf2r	UTSW	17	12733903	nonsense	probably null
R1994:Igf2r	UTSW	17	12692738	missense	probably benign
R2060:Igf2r	UTSW	17	12701319	missense	possibly damaging	0.92
R2108:Igf2r	UTSW	17	12698251	missense	probably benign	0.02
R2132:Igf2r	UTSW	17	12722208	missense	probably benign	0.12
R2314:Igf2r	UTSW	17	12715943	missense	probably benign	0.28
R2349:Igf2r	UTSW	17	12722311	splice site	probably null
R2696:Igf2r	UTSW	17	12695344	missense	possibly damaging	0.96
R2864:Igf2r	UTSW	17	12686724	missense	probably damaging	0.99
R2865:Igf2r	UTSW	17	12686724	missense	probably damaging	0.99
R3884:Igf2r	UTSW	17	12709468	missense	probably benign
R3930:Igf2r	UTSW	17	12705829	missense	probably benign	0.01
R4021:Igf2r	UTSW	17	12748751	missense	probably damaging	0.97
R4125:Igf2r	UTSW	17	12702254	missense	possibly damaging	0.93
R4342:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4343:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4345:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4760:Igf2r	UTSW	17	12703465	missense	possibly damaging	0.92
R4796:Igf2r	UTSW	17	12684126	missense	possibly damaging	0.70
R4816:Igf2r	UTSW	17	12684097	missense	probably damaging	0.96
R4826:Igf2r	UTSW	17	12701353	missense	probably damaging	0.98
R4933:Igf2r	UTSW	17	12691877	splice site	probably null
R4980:Igf2r	UTSW	17	12703360	critical splice donor site	probably null
R5389:Igf2r	UTSW	17	12725416	missense	probably damaging	1.00
R5473:Igf2r	UTSW	17	12695314	missense	probably benign	0.20
R5494:Igf2r	UTSW	17	12693145	missense	possibly damaging	0.74
R5619:Igf2r	UTSW	17	12739334	missense	probably damaging	1.00
R5738:Igf2r	UTSW	17	12717367	missense	probably benign	0.23
R5761:Igf2r	UTSW	17	12698352	splice site	probably null
R5794:Igf2r	UTSW	17	12709445	missense	probably benign	0.37
R6210:Igf2r	UTSW	17	12714951	missense	probably damaging	0.98
R6319:Igf2r	UTSW	17	12714113	missense	probably damaging	1.00
R6388:Igf2r	UTSW	17	12683900	missense	probably benign
R6396:Igf2r	UTSW	17	12714090	missense	probably benign	0.00
R6584:Igf2r	UTSW	17	12701250	missense	probably damaging	0.99
R6590:Igf2r	UTSW	17	12691937	nonsense	probably null
R6591:Igf2r	UTSW	17	12689008	missense	probably damaging	1.00
R6599:Igf2r	UTSW	17	12698618	missense	possibly damaging	0.85
R6690:Igf2r	UTSW	17	12691937	nonsense	probably null
R6691:Igf2r	UTSW	17	12689008	missense	probably damaging	1.00
R6752:Igf2r	UTSW	17	12714944	missense	probably damaging	1.00
R6816:Igf2r	UTSW	17	12714082	missense	probably damaging	0.99
R6841:Igf2r	UTSW	17	12703376	missense	probably damaging	0.97
R6877:Igf2r	UTSW	17	12697341	missense	probably damaging	0.97
R6950:Igf2r	UTSW	17	12718718	missense	probably benign
R7038:Igf2r	UTSW	17	12698325	missense	probably benign	0.23
R7055:Igf2r	UTSW	17	12704323	missense	probably damaging	0.99
R7074:Igf2r	UTSW	17	12714116	missense	possibly damaging	0.57
R7348:Igf2r	UTSW	17	12703484	missense	probably damaging	0.99
R7413:Igf2r	UTSW	17	12698228	nonsense	probably null
R7463:Igf2r	UTSW	17	12710645	missense	probably benign	0.16
R7619:Igf2r	UTSW	17	12698273	missense	possibly damaging	0.88
R7730:Igf2r	UTSW	17	12735991	missense	probably damaging	0.98
R7733:Igf2r	UTSW	17	12739369	missense	possibly damaging	0.90
R7881:Igf2r	UTSW	17	12748704	missense	probably benign
R8022:Igf2r	UTSW	17	12718795	missense	probably damaging	1.00
R8138:Igf2r	UTSW	17	12701238	missense	probably benign	0.32
R8220:Igf2r	UTSW	17	12692071	missense	probably benign	0.22
R8305:Igf2r	UTSW	17	12733860	missense	probably benign
R8359:Igf2r	UTSW	17	12683861	missense	probably benign
R8500:Igf2r	UTSW	17	12709441	missense	probably damaging	0.99
R8510:Igf2r	UTSW	17	12704313	missense	probably benign	0.38
R8933:Igf2r	UTSW	17	12701244	missense	probably damaging	0.97
R8933:Igf2r	UTSW	17	12704637	missense	probably damaging	1.00
R8976:Igf2r	UTSW	17	12726772	missense	probably damaging	1.00
R8994:Igf2r	UTSW	17	12716650	missense	possibly damaging	0.87
R9059:Igf2r	UTSW	17	12751293	start codon destroyed	probably null
R9097:Igf2r	UTSW	17	12691213	missense	probably damaging	1.00
R9127:Igf2r	UTSW	17	12739351	missense	probably damaging	0.98
R9278:Igf2r	UTSW	17	12695353	missense	probably damaging	1.00
R9362:Igf2r	UTSW	17	12722175	missense	probably benign	0.02
R9371:Igf2r	UTSW	17	12705759	missense	possibly damaging	0.93
R9522:Igf2r	UTSW	17	12698328	missense	probably benign	0.26
R9567:Igf2r	UTSW	17	12686754	missense	probably damaging	1.00
R9665:Igf2r	UTSW	17	12694140	missense	probably benign	0.17
R9666:Igf2r	UTSW	17	12726701	missense	probably benign
X0028:Igf2r	UTSW	17	12704913	nonsense	probably null
Z1177:Igf2r	UTSW	17	12697399	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTTTGATCATGCCAGCCACC -3'
(R):5'- GGAAAGGTGGTGGTCTCATC -3'

Sequencing Primer
(F):5'- GATCATGCCAGCCACCCATTAC -3'
(R):5'- TCTCATCCAGAGTGAGCCTCAG -3'

Posted On

2019-05-13