Incidental Mutation 'R7031:Ly96'
ID546301
Institutional Source Beutler Lab
Gene Symbol Ly96
Ensembl Gene ENSMUSG00000025779
Gene Namelymphocyte antigen 96
SynonymsMD-2, ESOP-1, MD2, myeloid differentiation factor-2
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_016923; MGI: 1341909

Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R7031 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location16688051-16709611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 16688563 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 19 (E19V)
Ref Sequence ENSEMBL: ENSMUSP00000026881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026881] [ENSMUST00000190366]
PDB Structure
Crystal structure of mouse TLR4 and mouse MD-2 complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/lipid IVa complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/LPS complex [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026881
AA Change: E19V

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000026881
Gene: ENSMUSG00000025779
AA Change: E19V

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
ML 34 153 7.82e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190366
AA Change: E19V

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140411
Gene: ENSMUSG00000025779
AA Change: E19V

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:E1_DerP2_DerF2 66 137 1.8e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which associates with toll-like receptor 4 on the cell surface and confers responsiveness to lipopolysaccyaride (LPS), thus providing a link between the receptor and LPS signaling. Studies of the mouse ortholog suggest that this gene may be involved in endotoxin neutralization. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired responsiveness to LPS, are resistant to LPS-induced lethal toxicity but show increased susceptibility to Salmonella typhimurium infection. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,968,103 I128V probably benign Het
4930432K21Rik C A 8: 84,166,684 P160Q possibly damaging Het
4931414P19Rik T C 14: 54,595,601 N39S probably benign Het
Abca13 C T 11: 9,621,892 R4818C probably damaging Het
Acadsb A G 7: 131,443,637 I433V probably benign Het
Acsl3 T A 1: 78,688,283 I142N probably benign Het
Api5 G A 2: 94,425,616 T242M probably benign Het
Ccdc88c T C 12: 100,945,064 E37G probably damaging Het
Cntnap4 C A 8: 112,858,242 Q1104K probably benign Het
Cry1 A G 10: 85,148,662 S183P probably benign Het
Cuzd1 A T 7: 131,308,851 F572I probably benign Het
Dcbld1 A T 10: 52,290,889 D104V probably damaging Het
Dhh C T 15: 98,894,026 G367E possibly damaging Het
Dhx15 T C 5: 52,184,589 D129G probably benign Het
Drd3 T A 16: 43,762,498 V86E probably damaging Het
Ebf1 A G 11: 44,621,968 T135A possibly damaging Het
Epha5 T C 5: 84,142,300 I428V probably benign Het
Epx T A 11: 87,875,523 probably benign Het
Fam83d T A 2: 158,785,307 N305K probably benign Het
Gchfr T A 2: 119,169,755 V39D probably benign Het
Ggnbp2 A G 11: 84,860,641 L111P probably damaging Het
Gnal G A 18: 67,222,588 G340D probably damaging Het
Gpat2 A G 2: 127,435,475 E745G probably damaging Het
Gpbp1l1 C T 4: 116,592,848 R438C probably damaging Het
Hmgxb4 C T 8: 75,029,572 Q171* probably null Het
Igkv4-91 G T 6: 68,768,558 R119S possibly damaging Het
Ing2 T C 8: 47,668,823 D230G probably benign Het
Itfg2 A G 6: 128,416,054 V82A probably damaging Het
Klhl22 T C 16: 17,777,026 S340P probably damaging Het
Lipm A T 19: 34,116,471 M263L probably benign Het
Mark1 C T 1: 184,912,632 E376K possibly damaging Het
Mlip T A 9: 77,138,553 M375L probably benign Het
Mug1 A T 6: 121,838,714 N26Y probably benign Het
Olfr1032 C T 2: 86,008,595 A273V probably benign Het
Olfr1368 C T 13: 21,143,000 S19N probably benign Het
Olfr543 T A 7: 102,477,850 T7S probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rb1cc1 T C 1: 6,238,466 probably null Het
Rgs4 T C 1: 169,743,767 T178A probably benign Het
Sel1l2 T A 2: 140,340,123 K31N possibly damaging Het
Serpinf1 T C 11: 75,410,196 R398G probably damaging Het
Sgo2b C T 8: 63,940,044 E120K possibly damaging Het
Stard9 T C 2: 120,700,450 F2396S possibly damaging Het
Tcrg-V6 G A 13: 19,190,440 E25K probably benign Het
Trpc3 A C 3: 36,621,310 I893S probably benign Het
Trpc4ap C A 2: 155,692,215 R31L unknown Het
Vat1l A G 8: 114,271,432 R239G possibly damaging Het
Vmn1r56 T A 7: 5,196,262 R119* probably null Het
Vmn2r111 T C 17: 22,571,245 Y260C probably damaging Het
Zfp664 A G 5: 124,886,006 T155A probably benign Het
Other mutations in Ly96
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Ly96 APN 1 16706228 splice site probably null
IGL01588:Ly96 APN 1 16709454 missense probably benign 0.11
pique UTSW 1 16691716 nonsense probably null
H8562:Ly96 UTSW 1 16691694 missense probably damaging 1.00
R1186:Ly96 UTSW 1 16700894 missense possibly damaging 0.90
R1751:Ly96 UTSW 1 16706175 missense probably benign 0.00
R1767:Ly96 UTSW 1 16706175 missense probably benign 0.00
R4645:Ly96 UTSW 1 16691716 nonsense probably null
R5189:Ly96 UTSW 1 16700867 missense probably damaging 1.00
R5470:Ly96 UTSW 1 16709486 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AAGCAGTTGGATGGGAGCTTC -3'
(R):5'- AGCAATTCAGAGGTCCTGGG -3'

Sequencing Primer
(F):5'- TTGGATGGGAGCTTCCAAATCAC -3'
(R):5'- AAGTGGTCGGCATTGCTCC -3'
Posted On2019-05-13