Incidental Mutation 'R7031:Rgs4'
ID546303
Institutional Source Beutler Lab
Gene Symbol Rgs4
Ensembl Gene ENSMUSG00000038530
Gene Nameregulator of G-protein signaling 4
SynonymsESTM48, ESTM50
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R7031 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location169741477-169747642 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 169743767 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 178 (T178A)
Ref Sequence ENSEMBL: ENSMUSP00000027991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027991] [ENSMUST00000111357]
Predicted Effect probably benign
Transcript: ENSMUST00000027991
AA Change: T178A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027991
Gene: ENSMUSG00000038530
AA Change: T178A

DomainStartEndE-ValueType
low complexity region 29 44 N/A INTRINSIC
RGS 62 178 4.01e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111357
SMART Domains Protein: ENSMUSP00000106989
Gene: ENSMUSG00000038530

DomainStartEndE-ValueType
PDB:1AGR|H 1 71 4e-31 PDB
Blast:RGS 8 58 3e-13 BLAST
SCOP:d1agre_ 51 70 5e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Regulator of G protein signaling (RGS) family members are regulatory molecules that act as GTPase activating proteins (GAPs) for G alpha subunits of heterotrimeric G proteins. RGS proteins are able to deactivate G protein subunits of the Gi alpha, Go alpha and Gq alpha subtypes. They drive G proteins into their inactive GDP-bound forms. Regulator of G protein signaling 4 belongs to this family. All RGS proteins share a conserved 120-amino acid sequence termed the RGS domain. Regulator of G protein signaling 4 protein is 37% identical to RGS1 and 97% identical to rat Rgs4. This protein negatively regulate signaling upstream or at the level of the heterotrimeric G protein and is localized in the cytoplasm. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one null allele display background dependent partially penetrant embryonic lethality, decreased body weight, and mildly impaired coordination. Another allele displays increased cholesterol levels in males. Mice homozygous for a different null allele exhibit no normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,968,103 I128V probably benign Het
4930432K21Rik C A 8: 84,166,684 P160Q possibly damaging Het
4931414P19Rik T C 14: 54,595,601 N39S probably benign Het
Abca13 C T 11: 9,621,892 R4818C probably damaging Het
Acadsb A G 7: 131,443,637 I433V probably benign Het
Acsl3 T A 1: 78,688,283 I142N probably benign Het
Api5 G A 2: 94,425,616 T242M probably benign Het
Ccdc88c T C 12: 100,945,064 E37G probably damaging Het
Cntnap4 C A 8: 112,858,242 Q1104K probably benign Het
Cry1 A G 10: 85,148,662 S183P probably benign Het
Cuzd1 A T 7: 131,308,851 F572I probably benign Het
Dcbld1 A T 10: 52,290,889 D104V probably damaging Het
Dhh C T 15: 98,894,026 G367E possibly damaging Het
Dhx15 T C 5: 52,184,589 D129G probably benign Het
Drd3 T A 16: 43,762,498 V86E probably damaging Het
Ebf1 A G 11: 44,621,968 T135A possibly damaging Het
Epha5 T C 5: 84,142,300 I428V probably benign Het
Epx T A 11: 87,875,523 probably benign Het
Fam83d T A 2: 158,785,307 N305K probably benign Het
Gchfr T A 2: 119,169,755 V39D probably benign Het
Ggnbp2 A G 11: 84,860,641 L111P probably damaging Het
Gnal G A 18: 67,222,588 G340D probably damaging Het
Gpat2 A G 2: 127,435,475 E745G probably damaging Het
Gpbp1l1 C T 4: 116,592,848 R438C probably damaging Het
Hmgxb4 C T 8: 75,029,572 Q171* probably null Het
Igkv4-91 G T 6: 68,768,558 R119S possibly damaging Het
Ing2 T C 8: 47,668,823 D230G probably benign Het
Itfg2 A G 6: 128,416,054 V82A probably damaging Het
Klhl22 T C 16: 17,777,026 S340P probably damaging Het
Lipm A T 19: 34,116,471 M263L probably benign Het
Ly96 A T 1: 16,688,563 E19V possibly damaging Het
Mark1 C T 1: 184,912,632 E376K possibly damaging Het
Mlip T A 9: 77,138,553 M375L probably benign Het
Mug1 A T 6: 121,838,714 N26Y probably benign Het
Olfr1032 C T 2: 86,008,595 A273V probably benign Het
Olfr1368 C T 13: 21,143,000 S19N probably benign Het
Olfr543 T A 7: 102,477,850 T7S probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rb1cc1 T C 1: 6,238,466 probably null Het
Sel1l2 T A 2: 140,340,123 K31N possibly damaging Het
Serpinf1 T C 11: 75,410,196 R398G probably damaging Het
Sgo2b C T 8: 63,940,044 E120K possibly damaging Het
Stard9 T C 2: 120,700,450 F2396S possibly damaging Het
Tcrg-V6 G A 13: 19,190,440 E25K probably benign Het
Trpc3 A C 3: 36,621,310 I893S probably benign Het
Trpc4ap C A 2: 155,692,215 R31L unknown Het
Vat1l A G 8: 114,271,432 R239G possibly damaging Het
Vmn1r56 T A 7: 5,196,262 R119* probably null Het
Vmn2r111 T C 17: 22,571,245 Y260C probably damaging Het
Zfp664 A G 5: 124,886,006 T155A probably benign Het
Other mutations in Rgs4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Rgs4 APN 1 169744516 nonsense probably null
IGL01624:Rgs4 APN 1 169744478 missense probably benign 0.00
R1654:Rgs4 UTSW 1 169745311 missense probably benign 0.06
R1775:Rgs4 UTSW 1 169745278 missense probably benign 0.00
R3790:Rgs4 UTSW 1 169744422 missense probably damaging 0.99
R4998:Rgs4 UTSW 1 169745233 missense probably benign 0.26
R5934:Rgs4 UTSW 1 169745238 missense possibly damaging 0.95
R7571:Rgs4 UTSW 1 169744358 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACACTAGGCTACAATGTGG -3'
(R):5'- TCTTCAACAGGGCACTAGATC -3'

Sequencing Primer
(F):5'- CACTAGGCTACAATGTGGATAAAGC -3'
(R):5'- GGGCACTAGATCTAATGCAACCTTG -3'
Posted On2019-05-13