Incidental Mutation 'R7031:Mark1'
ID546304
Institutional Source Beutler Lab
Gene Symbol Mark1
Ensembl Gene ENSMUSG00000026620
Gene NameMAP/microtubule affinity regulating kinase 1
SynonymsEmk3, B930025N23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.286) question?
Stock #R7031 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location184896789-184999570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 184912632 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 376 (E376K)
Ref Sequence ENSEMBL: ENSMUSP00000027929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027929]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027929
AA Change: E376K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027929
Gene: ENSMUSG00000026620
AA Change: E376K

DomainStartEndE-ValueType
S_TKc 60 311 1.12e-108 SMART
low complexity region 316 328 N/A INTRINSIC
UBA 332 369 4.56e-9 SMART
low complexity region 376 386 N/A INTRINSIC
low complexity region 523 547 N/A INTRINSIC
low complexity region 585 599 N/A INTRINSIC
Pfam:KA1 751 795 4.5e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,968,103 I128V probably benign Het
4930432K21Rik C A 8: 84,166,684 P160Q possibly damaging Het
4931414P19Rik T C 14: 54,595,601 N39S probably benign Het
Abca13 C T 11: 9,621,892 R4818C probably damaging Het
Acadsb A G 7: 131,443,637 I433V probably benign Het
Acsl3 T A 1: 78,688,283 I142N probably benign Het
Api5 G A 2: 94,425,616 T242M probably benign Het
Ccdc88c T C 12: 100,945,064 E37G probably damaging Het
Cntnap4 C A 8: 112,858,242 Q1104K probably benign Het
Cry1 A G 10: 85,148,662 S183P probably benign Het
Cuzd1 A T 7: 131,308,851 F572I probably benign Het
Dcbld1 A T 10: 52,290,889 D104V probably damaging Het
Dhh C T 15: 98,894,026 G367E possibly damaging Het
Dhx15 T C 5: 52,184,589 D129G probably benign Het
Drd3 T A 16: 43,762,498 V86E probably damaging Het
Ebf1 A G 11: 44,621,968 T135A possibly damaging Het
Epha5 T C 5: 84,142,300 I428V probably benign Het
Epx T A 11: 87,875,523 probably benign Het
Fam83d T A 2: 158,785,307 N305K probably benign Het
Gchfr T A 2: 119,169,755 V39D probably benign Het
Ggnbp2 A G 11: 84,860,641 L111P probably damaging Het
Gnal G A 18: 67,222,588 G340D probably damaging Het
Gpat2 A G 2: 127,435,475 E745G probably damaging Het
Gpbp1l1 C T 4: 116,592,848 R438C probably damaging Het
Hmgxb4 C T 8: 75,029,572 Q171* probably null Het
Igkv4-91 G T 6: 68,768,558 R119S possibly damaging Het
Ing2 T C 8: 47,668,823 D230G probably benign Het
Itfg2 A G 6: 128,416,054 V82A probably damaging Het
Klhl22 T C 16: 17,777,026 S340P probably damaging Het
Lipm A T 19: 34,116,471 M263L probably benign Het
Ly96 A T 1: 16,688,563 E19V possibly damaging Het
Mlip T A 9: 77,138,553 M375L probably benign Het
Mug1 A T 6: 121,838,714 N26Y probably benign Het
Olfr1032 C T 2: 86,008,595 A273V probably benign Het
Olfr1368 C T 13: 21,143,000 S19N probably benign Het
Olfr543 T A 7: 102,477,850 T7S probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rb1cc1 T C 1: 6,238,466 probably null Het
Rgs4 T C 1: 169,743,767 T178A probably benign Het
Sel1l2 T A 2: 140,340,123 K31N possibly damaging Het
Serpinf1 T C 11: 75,410,196 R398G probably damaging Het
Sgo2b C T 8: 63,940,044 E120K possibly damaging Het
Stard9 T C 2: 120,700,450 F2396S possibly damaging Het
Tcrg-V6 G A 13: 19,190,440 E25K probably benign Het
Trpc3 A C 3: 36,621,310 I893S probably benign Het
Trpc4ap C A 2: 155,692,215 R31L unknown Het
Vat1l A G 8: 114,271,432 R239G possibly damaging Het
Vmn1r56 T A 7: 5,196,262 R119* probably null Het
Vmn2r111 T C 17: 22,571,245 Y260C probably damaging Het
Zfp664 A G 5: 124,886,006 T155A probably benign Het
Other mutations in Mark1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Mark1 APN 1 184898603 missense probably damaging 1.00
IGL00674:Mark1 APN 1 184912106 missense probably benign
IGL01903:Mark1 APN 1 184929380 splice site probably benign
IGL02004:Mark1 APN 1 184912589 missense possibly damaging 0.82
IGL03177:Mark1 APN 1 184944907 missense probably damaging 1.00
IGL03189:Mark1 APN 1 184919693 missense probably damaging 0.96
IGL03391:Mark1 APN 1 184919435 unclassified probably benign
R0277:Mark1 UTSW 1 184944952 missense possibly damaging 0.89
R0744:Mark1 UTSW 1 184921608 missense probably damaging 1.00
R0973:Mark1 UTSW 1 184921604 missense probably damaging 1.00
R1331:Mark1 UTSW 1 184928048 missense probably damaging 1.00
R2061:Mark1 UTSW 1 184928063 missense probably damaging 1.00
R2136:Mark1 UTSW 1 184919573 missense probably damaging 1.00
R2306:Mark1 UTSW 1 184900861 splice site probably benign
R3159:Mark1 UTSW 1 184908387 missense probably damaging 1.00
R3905:Mark1 UTSW 1 184908435 splice site probably null
R4321:Mark1 UTSW 1 184898674 missense possibly damaging 0.46
R4512:Mark1 UTSW 1 184907089 missense probably benign 0.21
R4715:Mark1 UTSW 1 184912132 missense probably benign 0.00
R4829:Mark1 UTSW 1 184905527 missense possibly damaging 0.82
R5163:Mark1 UTSW 1 184905610 missense probably damaging 0.98
R5222:Mark1 UTSW 1 184928091 missense probably damaging 1.00
R5680:Mark1 UTSW 1 184944816 missense probably damaging 1.00
R6582:Mark1 UTSW 1 184912589 missense possibly damaging 0.82
R6943:Mark1 UTSW 1 184898787 missense probably damaging 1.00
R6979:Mark1 UTSW 1 184912628 missense possibly damaging 0.77
R7455:Mark1 UTSW 1 184919750 missense probably damaging 0.99
R7470:Mark1 UTSW 1 184928044 nonsense probably null
R7715:Mark1 UTSW 1 184907234 missense probably damaging 0.98
R8193:Mark1 UTSW 1 184928052 missense probably damaging 0.99
R8474:Mark1 UTSW 1 184919586 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGATCGGTCAGTCACCCAG -3'
(R):5'- CACCTGGAGACGCATGTTAATG -3'

Sequencing Primer
(F):5'- GGCCAGAATGCCCCCTTCTTAG -3'
(R):5'- AATGCATCCCGTGTTTGAGGC -3'
Posted On2019-05-13