Incidental Mutation 'R7031:Olfr1032'
ID546305
Institutional Source Beutler Lab
Gene Symbol Olfr1032
Ensembl Gene ENSMUSG00000042796
Gene Nameolfactory receptor 1032
SynonymsGA_x6K02T2Q125-47485813-47486745, MOR199-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R7031 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location86005540-86009125 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86008595 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 273 (A273V)
Ref Sequence ENSEMBL: ENSMUSP00000107216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062166] [ENSMUST00000079298] [ENSMUST00000111589]
Predicted Effect probably benign
Transcript: ENSMUST00000062166
AA Change: A273V

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000054494
Gene: ENSMUSG00000042796
AA Change: A273V

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5.6e-50 PFAM
Pfam:7tm_1 39 288 1.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079298
AA Change: A273V

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000078279
Gene: ENSMUSG00000042796
AA Change: A273V

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.3e-50 PFAM
Pfam:7tm_1 39 288 9.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111589
AA Change: A273V

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107216
Gene: ENSMUSG00000042796
AA Change: A273V

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.4e-50 PFAM
Pfam:7tm_1 39 288 3.5e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,968,103 I128V probably benign Het
4930432K21Rik C A 8: 84,166,684 P160Q possibly damaging Het
4931414P19Rik T C 14: 54,595,601 N39S probably benign Het
Abca13 C T 11: 9,621,892 R4818C probably damaging Het
Acadsb A G 7: 131,443,637 I433V probably benign Het
Acsl3 T A 1: 78,688,283 I142N probably benign Het
Api5 G A 2: 94,425,616 T242M probably benign Het
Ccdc88c T C 12: 100,945,064 E37G probably damaging Het
Cntnap4 C A 8: 112,858,242 Q1104K probably benign Het
Cry1 A G 10: 85,148,662 S183P probably benign Het
Cuzd1 A T 7: 131,308,851 F572I probably benign Het
Dcbld1 A T 10: 52,290,889 D104V probably damaging Het
Dhh C T 15: 98,894,026 G367E possibly damaging Het
Dhx15 T C 5: 52,184,589 D129G probably benign Het
Drd3 T A 16: 43,762,498 V86E probably damaging Het
Ebf1 A G 11: 44,621,968 T135A possibly damaging Het
Epha5 T C 5: 84,142,300 I428V probably benign Het
Epx T A 11: 87,875,523 probably benign Het
Fam83d T A 2: 158,785,307 N305K probably benign Het
Gchfr T A 2: 119,169,755 V39D probably benign Het
Ggnbp2 A G 11: 84,860,641 L111P probably damaging Het
Gnal G A 18: 67,222,588 G340D probably damaging Het
Gpat2 A G 2: 127,435,475 E745G probably damaging Het
Gpbp1l1 C T 4: 116,592,848 R438C probably damaging Het
Hmgxb4 C T 8: 75,029,572 Q171* probably null Het
Igkv4-91 G T 6: 68,768,558 R119S possibly damaging Het
Ing2 T C 8: 47,668,823 D230G probably benign Het
Itfg2 A G 6: 128,416,054 V82A probably damaging Het
Klhl22 T C 16: 17,777,026 S340P probably damaging Het
Lipm A T 19: 34,116,471 M263L probably benign Het
Ly96 A T 1: 16,688,563 E19V possibly damaging Het
Mark1 C T 1: 184,912,632 E376K possibly damaging Het
Mlip T A 9: 77,138,553 M375L probably benign Het
Mug1 A T 6: 121,838,714 N26Y probably benign Het
Olfr1368 C T 13: 21,143,000 S19N probably benign Het
Olfr543 T A 7: 102,477,850 T7S probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rb1cc1 T C 1: 6,238,466 probably null Het
Rgs4 T C 1: 169,743,767 T178A probably benign Het
Sel1l2 T A 2: 140,340,123 K31N possibly damaging Het
Serpinf1 T C 11: 75,410,196 R398G probably damaging Het
Sgo2b C T 8: 63,940,044 E120K possibly damaging Het
Stard9 T C 2: 120,700,450 F2396S possibly damaging Het
Tcrg-V6 G A 13: 19,190,440 E25K probably benign Het
Trpc3 A C 3: 36,621,310 I893S probably benign Het
Trpc4ap C A 2: 155,692,215 R31L unknown Het
Vat1l A G 8: 114,271,432 R239G possibly damaging Het
Vmn1r56 T A 7: 5,196,262 R119* probably null Het
Vmn2r111 T C 17: 22,571,245 Y260C probably damaging Het
Zfp664 A G 5: 124,886,006 T155A probably benign Het
Other mutations in Olfr1032
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Olfr1032 APN 2 86008547 missense probably damaging 1.00
IGL03110:Olfr1032 APN 2 86008598 missense probably damaging 0.99
IGL03167:Olfr1032 APN 2 86008167 nonsense probably null
R0206:Olfr1032 UTSW 2 86008292 missense probably damaging 1.00
R0206:Olfr1032 UTSW 2 86008292 missense probably damaging 1.00
R0919:Olfr1032 UTSW 2 86008640 missense possibly damaging 0.52
R2018:Olfr1032 UTSW 2 86008223 missense probably damaging 1.00
R2019:Olfr1032 UTSW 2 86008223 missense probably damaging 1.00
R2938:Olfr1032 UTSW 2 86008013 missense probably damaging 0.97
R3843:Olfr1032 UTSW 2 86008204 missense probably benign 0.09
R4295:Olfr1032 UTSW 2 86008270 missense probably benign 0.01
R5813:Olfr1032 UTSW 2 86008292 missense probably damaging 1.00
R6283:Olfr1032 UTSW 2 86008099 missense possibly damaging 0.73
R7427:Olfr1032 UTSW 2 86008219 missense probably benign 0.00
R7428:Olfr1032 UTSW 2 86008219 missense probably benign 0.00
R7856:Olfr1032 UTSW 2 86008296 missense probably damaging 0.99
R8048:Olfr1032 UTSW 2 86008180 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACTTGCAGGCATTAACTTCAC -3'
(R):5'- CCCACACTTTATATATCCATGCATGAG -3'

Sequencing Primer
(F):5'- GCAGGCATTAACTTCACATATTCAC -3'
(R):5'- TATCCATGCATGAGAAAAGAATGC -3'
Posted On2019-05-13