Incidental Mutation 'R0610:Lca5'
ID54631
Institutional Source Beutler Lab
Gene Symbol Lca5
Ensembl Gene ENSMUSG00000032258
Gene NameLeber congenital amaurosis 5 (human)
Synonyms4930431B11Rik, 5730406O13Rik, ORF64
MMRRC Submission 038799-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.578) question?
Stock #R0610 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location83390293-83441127 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83399739 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 331 (C331S)
Ref Sequence ENSEMBL: ENSMUSP00000140753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034791] [ENSMUST00000034793] [ENSMUST00000190514]
Predicted Effect probably benign
Transcript: ENSMUST00000034791
AA Change: C331S

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000034791
Gene: ENSMUSG00000032258
AA Change: C331S

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
Pfam:Lebercilin 103 295 2.6e-66 PFAM
low complexity region 306 315 N/A INTRINSIC
low complexity region 617 627 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000034793
AA Change: C331S

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000034793
Gene: ENSMUSG00000032258
AA Change: C331S

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
Pfam:Lebercilin 102 295 4.8e-71 PFAM
low complexity region 306 315 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190514
AA Change: C331S

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140753
Gene: ENSMUSG00000032258
AA Change: C331S

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
Pfam:Lebercilin 102 295 5.8e-71 PFAM
low complexity region 306 315 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191225
Meta Mutation Damage Score 0.0797 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is thought to be involved in centrosomal or ciliary functions. Mutations in this gene cause Leber congenital amaurosis type V. Alternatively spliced transcript variants are described. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit retinal patches of depigmentation, lack rod and cone ERG responses to light stimuli, and show loss of ciliary intraflagellar transport function in photoreceptors leading to failure of outer segment formation and photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4930578I06Rik G A 14: 63,986,265 R21* probably null Het
9530003J23Rik A G 10: 117,237,730 F66S probably benign Het
Abca15 A G 7: 120,365,786 E757G possibly damaging Het
Abca5 T C 11: 110,301,527 T720A probably benign Het
Actr5 T A 2: 158,632,456 probably null Het
Adgrl3 T C 5: 81,693,716 probably benign Het
Adra1a A G 14: 66,637,792 D72G probably damaging Het
Ahnak G T 19: 9,007,878 L2175F probably benign Het
AK157302 A G 13: 21,495,663 T120A possibly damaging Het
Apol7a G A 15: 77,389,254 A336V probably benign Het
Asic1 C A 15: 99,698,899 H525Q probably benign Het
Atxn7l2 T C 3: 108,204,774 D335G possibly damaging Het
Bpgm G T 6: 34,504,349 R227L possibly damaging Het
Calm4 T A 13: 3,838,320 V142E possibly damaging Het
Catsperg1 A T 7: 29,190,619 L721Q probably damaging Het
Cdh26 A G 2: 178,449,898 I83M probably damaging Het
Cep295 A C 9: 15,322,754 S2249A possibly damaging Het
Cln3 A G 7: 126,580,189 F139L probably damaging Het
Cmpk2 T A 12: 26,478,056 L424Q possibly damaging Het
Col12a1 A T 9: 79,707,848 V53E probably benign Het
Csmd1 G A 8: 15,918,208 R3140C possibly damaging Het
Dagla A G 19: 10,271,558 W11R probably damaging Het
Dbx2 C T 15: 95,624,897 V310M probably benign Het
Disp2 T A 2: 118,792,236 C1150S probably benign Het
Dock3 T C 9: 107,023,788 D326G probably damaging Het
Dph1 G T 11: 75,185,957 probably benign Het
Dyrk1b C A 7: 28,186,634 T594K probably damaging Het
Evx2 C A 2: 74,655,987 A353S probably benign Het
Fam71f1 T A 6: 29,326,577 V231E probably benign Het
Gm4737 T C 16: 46,153,901 E371G probably damaging Het
Gm4788 G A 1: 139,701,846 T799I probably benign Het
Greb1 A C 12: 16,696,442 S1276A probably benign Het
Hhipl1 T A 12: 108,319,402 C490* probably null Het
Hmmr G T 11: 40,715,902 T231K probably damaging Het
Hspa4l A C 3: 40,779,400 E526D probably benign Het
Ibsp A G 5: 104,310,134 E179G probably benign Het
Ift140 C T 17: 25,035,803 A150V probably benign Het
Igf2bp2 A G 16: 22,070,309 S416P probably benign Het
Ighe T C 12: 113,271,743 K294E unknown Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kng2 T A 16: 23,000,594 N231Y possibly damaging Het
Lrrc1 A G 9: 77,472,206 I101T possibly damaging Het
Lrrk2 A T 15: 91,815,416 I2489L probably benign Het
Mapk9 A C 11: 49,863,573 N51T probably benign Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Nek2 T A 1: 191,822,515 V113D probably damaging Het
Nr4a3 C A 4: 48,051,903 A248E probably benign Het
Nrp1 T C 8: 128,502,618 I859T probably damaging Het
Olfm5 A T 7: 104,154,445 Y195* probably null Het
Olfr354 T A 2: 36,907,659 W238R probably damaging Het
Olfr71 T A 4: 43,706,400 H56L possibly damaging Het
Olfr955 A G 9: 39,469,823 L301P probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pcnx2 A G 8: 125,839,687 W1006R probably damaging Het
Pdpk1 T C 17: 24,098,171 probably null Het
Ryr2 T A 13: 11,622,952 H3731L probably damaging Het
Sdr16c5 T G 4: 4,016,116 E103D possibly damaging Het
Setdb2 A C 14: 59,417,470 S324A possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc17a8 A T 10: 89,576,626 I499K probably damaging Het
Slc2a9 T A 5: 38,379,942 I389F probably damaging Het
Slc30a1 T C 1: 191,909,424 V394A probably damaging Het
Slc41a2 A G 10: 83,283,728 I390T possibly damaging Het
Slco1a1 A G 6: 141,918,461 probably null Het
Slit2 A G 5: 48,275,674 K1053E possibly damaging Het
Smarca2 T A 19: 26,691,391 L930Q probably damaging Het
Snx6 T C 12: 54,751,789 H387R probably damaging Het
Sox5 A T 6: 143,833,439 M622K possibly damaging Het
Ston1 C A 17: 88,635,281 N38K possibly damaging Het
Strbp C T 2: 37,584,077 V658I probably damaging Het
Strn3 T C 12: 51,610,448 probably null Het
Suco T G 1: 161,859,503 D96A probably benign Het
Suco A G 1: 161,864,032 probably benign Het
Sytl2 A T 7: 90,380,853 probably benign Het
Tmem41b T A 7: 109,981,083 M25L probably benign Het
Tmem41b T A 7: 109,981,085 D91V probably damaging Het
Tmem50b C T 16: 91,583,286 A68T probably damaging Het
Tmprss11e G A 5: 86,707,347 Q400* probably null Het
Tnfsf13b G A 8: 10,031,661 probably null Het
Trappc8 A G 18: 20,837,188 V916A probably damaging Het
Trdn G T 10: 33,474,453 V673F probably damaging Het
Trim28 G T 7: 13,025,784 probably benign Het
Txnrd2 T C 16: 18,472,882 V427A probably damaging Het
Uggt1 T C 1: 36,165,506 probably benign Het
Vmn1r36 A G 6: 66,716,420 L51P probably damaging Het
Vmn1r63 T A 7: 5,803,064 M190L possibly damaging Het
Vmn2r116 T A 17: 23,387,312 N399K probably damaging Het
Vmn2r117 T C 17: 23,475,514 N453S probably benign Het
Wbp1l T A 19: 46,654,670 I370N probably damaging Het
Zfp445 T C 9: 122,852,981 K632E probably benign Het
Zfp850 C T 7: 27,989,394 R463H probably damaging Het
Zyg11a A G 4: 108,204,857 L249P probably damaging Het
Other mutations in Lca5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01073:Lca5 APN 9 83395475 missense probably damaging 0.98
IGL01349:Lca5 APN 9 83426617 missense probably damaging 1.00
IGL01918:Lca5 APN 9 83423148 missense probably damaging 1.00
IGL02035:Lca5 APN 9 83423312 missense probably damaging 1.00
IGL02276:Lca5 APN 9 83398585 missense possibly damaging 0.79
IGL02425:Lca5 APN 9 83399721 missense probably damaging 1.00
IGL02481:Lca5 APN 9 83423117 missense probably damaging 1.00
IGL02483:Lca5 APN 9 83423117 missense probably damaging 1.00
R0465:Lca5 UTSW 9 83395867 nonsense probably null
R0811:Lca5 UTSW 9 83399753 missense possibly damaging 0.95
R0812:Lca5 UTSW 9 83399753 missense possibly damaging 0.95
R0968:Lca5 UTSW 9 83423169 missense probably benign 0.01
R1891:Lca5 UTSW 9 83395608 missense probably damaging 1.00
R5223:Lca5 UTSW 9 83398613 missense probably benign 0.00
R5235:Lca5 UTSW 9 83423054 nonsense probably null
R5260:Lca5 UTSW 9 83423223 missense probably damaging 0.98
R5531:Lca5 UTSW 9 83398595 missense probably benign 0.00
R5558:Lca5 UTSW 9 83401743 missense probably damaging 0.99
R5688:Lca5 UTSW 9 83398566 missense probably benign 0.01
R5886:Lca5 UTSW 9 83399681 missense probably benign 0.31
R6426:Lca5 UTSW 9 83395654 nonsense probably null
R7108:Lca5 UTSW 9 83423169 missense probably benign 0.25
R7151:Lca5 UTSW 9 83398640 missense probably benign 0.20
R7314:Lca5 UTSW 9 83395510 missense possibly damaging 0.86
R7378:Lca5 UTSW 9 83395530 missense probably benign 0.00
R7468:Lca5 UTSW 9 83423456 missense probably damaging 0.99
R7686:Lca5 UTSW 9 83395239 missense probably benign 0.00
R8874:Lca5 UTSW 9 83395450 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAGGAACTTCCGACCACATTG -3'
(R):5'- GAAGCACCTACCTCTCACAGTTGC -3'

Sequencing Primer
(F):5'- GGTGCAAACAGCTTTCCTG -3'
(R):5'- caaatcccaaatagcattcacttc -3'
Posted On2013-07-11