Incidental Mutation 'R7031:Trpc3'
ID546313
Institutional Source Beutler Lab
Gene Symbol Trpc3
Ensembl Gene ENSMUSG00000027716
Gene Nametransient receptor potential cation channel, subfamily C, member 3
SynonymsTrp3, Trrp3, Trcp3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7031 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location36620482-36690167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 36621310 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 893 (I893S)
Ref Sequence ENSEMBL: ENSMUSP00000029271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029271]
Predicted Effect probably benign
Transcript: ENSMUST00000029271
AA Change: I893S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029271
Gene: ENSMUSG00000027716
AA Change: I893S

DomainStartEndE-ValueType
low complexity region 20 45 N/A INTRINSIC
low complexity region 47 68 N/A INTRINSIC
ANK 100 129 2.47e2 SMART
ANK 135 163 1.97e1 SMART
ANK 221 250 1.13e1 SMART
Pfam:TRP_2 256 318 3e-28 PFAM
transmembrane domain 414 433 N/A INTRINSIC
Pfam:Ion_trans 443 744 4.4e-34 PFAM
Pfam:PKD_channel 486 739 1.4e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that can form a non-selective channel permeable to calcium and other cations. The encoded protein appears to be induced to form channels by a receptor tyrosine kinase-activated phosphatidylinositol second messenger system and also by depletion of intracellular calcium stores. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous knockout mice or mice heterozygoous for a point mutation in exon 7 display an abnormal gait. Abnormal nervous system electrophysiology is also described. An A1903G point mutation in exon 7 results in homozygous lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,968,103 I128V probably benign Het
4930432K21Rik C A 8: 84,166,684 P160Q possibly damaging Het
4931414P19Rik T C 14: 54,595,601 N39S probably benign Het
Abca13 C T 11: 9,621,892 R4818C probably damaging Het
Acadsb A G 7: 131,443,637 I433V probably benign Het
Acsl3 T A 1: 78,688,283 I142N probably benign Het
Api5 G A 2: 94,425,616 T242M probably benign Het
Ccdc88c T C 12: 100,945,064 E37G probably damaging Het
Cntnap4 C A 8: 112,858,242 Q1104K probably benign Het
Cry1 A G 10: 85,148,662 S183P probably benign Het
Cuzd1 A T 7: 131,308,851 F572I probably benign Het
Dcbld1 A T 10: 52,290,889 D104V probably damaging Het
Dhh C T 15: 98,894,026 G367E possibly damaging Het
Dhx15 T C 5: 52,184,589 D129G probably benign Het
Drd3 T A 16: 43,762,498 V86E probably damaging Het
Ebf1 A G 11: 44,621,968 T135A possibly damaging Het
Epha5 T C 5: 84,142,300 I428V probably benign Het
Epx T A 11: 87,875,523 probably benign Het
Fam83d T A 2: 158,785,307 N305K probably benign Het
Gchfr T A 2: 119,169,755 V39D probably benign Het
Ggnbp2 A G 11: 84,860,641 L111P probably damaging Het
Gnal G A 18: 67,222,588 G340D probably damaging Het
Gpat2 A G 2: 127,435,475 E745G probably damaging Het
Gpbp1l1 C T 4: 116,592,848 R438C probably damaging Het
Hmgxb4 C T 8: 75,029,572 Q171* probably null Het
Igkv4-91 G T 6: 68,768,558 R119S possibly damaging Het
Ing2 T C 8: 47,668,823 D230G probably benign Het
Itfg2 A G 6: 128,416,054 V82A probably damaging Het
Klhl22 T C 16: 17,777,026 S340P probably damaging Het
Lipm A T 19: 34,116,471 M263L probably benign Het
Ly96 A T 1: 16,688,563 E19V possibly damaging Het
Mark1 C T 1: 184,912,632 E376K possibly damaging Het
Mlip T A 9: 77,138,553 M375L probably benign Het
Mug1 A T 6: 121,838,714 N26Y probably benign Het
Olfr1032 C T 2: 86,008,595 A273V probably benign Het
Olfr1368 C T 13: 21,143,000 S19N probably benign Het
Olfr543 T A 7: 102,477,850 T7S probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rb1cc1 T C 1: 6,238,466 probably null Het
Rgs4 T C 1: 169,743,767 T178A probably benign Het
Sel1l2 T A 2: 140,340,123 K31N possibly damaging Het
Serpinf1 T C 11: 75,410,196 R398G probably damaging Het
Sgo2b C T 8: 63,940,044 E120K possibly damaging Het
Stard9 T C 2: 120,700,450 F2396S possibly damaging Het
Tcrg-V6 G A 13: 19,190,440 E25K probably benign Het
Trpc4ap C A 2: 155,692,215 R31L unknown Het
Vat1l A G 8: 114,271,432 R239G possibly damaging Het
Vmn1r56 T A 7: 5,196,262 R119* probably null Het
Vmn2r111 T C 17: 22,571,245 Y260C probably damaging Het
Zfp664 A G 5: 124,886,006 T155A probably benign Het
Other mutations in Trpc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Trpc3 APN 3 36640639 missense possibly damaging 0.95
IGL01701:Trpc3 APN 3 36671594 missense possibly damaging 0.92
IGL02254:Trpc3 APN 3 36651520 missense probably null 0.98
IGL02723:Trpc3 APN 3 36650228 missense probably benign 0.02
IGL02816:Trpc3 APN 3 36651702 missense probably damaging 1.00
IGL02867:Trpc3 APN 3 36640701 missense probably benign 0.10
IGL02929:Trpc3 APN 3 36638474 nonsense probably null
IGL03076:Trpc3 APN 3 36640655 missense probably damaging 1.00
R0032:Trpc3 UTSW 3 36644256 missense probably damaging 1.00
R0032:Trpc3 UTSW 3 36644256 missense probably damaging 1.00
R0115:Trpc3 UTSW 3 36624417 missense probably benign 0.05
R0481:Trpc3 UTSW 3 36624417 missense probably benign 0.05
R0645:Trpc3 UTSW 3 36671505 missense probably benign 0.00
R0694:Trpc3 UTSW 3 36671555 missense possibly damaging 0.48
R1190:Trpc3 UTSW 3 36671348 missense probably benign 0.00
R1635:Trpc3 UTSW 3 36640627 missense probably damaging 1.00
R1828:Trpc3 UTSW 3 36638546 missense possibly damaging 0.95
R2204:Trpc3 UTSW 3 36650149 missense possibly damaging 0.79
R2937:Trpc3 UTSW 3 36634383 nonsense probably null
R3732:Trpc3 UTSW 3 36638559 missense probably benign
R3732:Trpc3 UTSW 3 36638559 missense probably benign
R3733:Trpc3 UTSW 3 36638559 missense probably benign
R4063:Trpc3 UTSW 3 36671023 missense probably damaging 1.00
R4270:Trpc3 UTSW 3 36662925 nonsense probably null
R4807:Trpc3 UTSW 3 36634382 missense probably benign 0.00
R4996:Trpc3 UTSW 3 36662818 missense probably benign 0.00
R5098:Trpc3 UTSW 3 36662898 missense probably benign 0.07
R5139:Trpc3 UTSW 3 36671557 missense possibly damaging 0.46
R5251:Trpc3 UTSW 3 36670954 missense probably damaging 1.00
R5337:Trpc3 UTSW 3 36638370 intron probably benign
R5891:Trpc3 UTSW 3 36671022 missense probably damaging 1.00
R6512:Trpc3 UTSW 3 36662758 missense possibly damaging 0.59
R6618:Trpc3 UTSW 3 36640695 missense possibly damaging 0.82
R6750:Trpc3 UTSW 3 36624393 missense probably damaging 1.00
R6950:Trpc3 UTSW 3 36638590 missense probably damaging 1.00
R6986:Trpc3 UTSW 3 36655016 critical splice donor site probably null
R7100:Trpc3 UTSW 3 36650067 missense probably benign 0.00
R7182:Trpc3 UTSW 3 36655109 missense probably benign 0.02
R7211:Trpc3 UTSW 3 36640733 missense possibly damaging 0.81
R7214:Trpc3 UTSW 3 36650137 missense possibly damaging 0.94
R7284:Trpc3 UTSW 3 36624413 missense probably damaging 0.98
R7468:Trpc3 UTSW 3 36624416 missense probably damaging 0.99
R7652:Trpc3 UTSW 3 36638528 missense probably benign 0.06
R7815:Trpc3 UTSW 3 36655145 missense probably benign 0.28
R7833:Trpc3 UTSW 3 36640672 missense probably damaging 0.96
R7977:Trpc3 UTSW 3 36644169 missense probably benign 0.13
R7987:Trpc3 UTSW 3 36644169 missense probably benign 0.13
R8778:Trpc3 UTSW 3 36670921 missense probably damaging 0.99
Z1177:Trpc3 UTSW 3 36621279 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATGGGAATCATGACCGCC -3'
(R):5'- TTGGGAAGCAAACATACTCAGATTG -3'

Sequencing Primer
(F):5'- CGCCTAGCTTAATTTTAAAGTTTCGC -3'
(R):5'- CACACAAATACCCTAGGTGA -3'
Posted On2019-05-13