Incidental Mutation 'R7031:Ing2'
ID546326
Institutional Source Beutler Lab
Gene Symbol Ing2
Ensembl Gene ENSMUSG00000063049
Gene Nameinhibitor of growth family, member 2
SynonymsIng1l, P33ING2, 2810011M06Rik, ING2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.300) question?
Stock #R7031 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location47667178-47675556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47668823 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 230 (D230G)
Ref Sequence ENSEMBL: ENSMUSP00000079226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080353]
PDB Structure Solution structure of PHD domain in inhibitor of growth family, member 1-like [SOLUTION NMR]
Crystal structure of ING2 PHD finger in complex with H3K4Me3 peptide [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000080353
AA Change: D230G

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000079226
Gene: ENSMUSG00000063049
AA Change: D230G

DomainStartEndE-ValueType
Pfam:ING 28 126 2e-26 PFAM
low complexity region 143 162 N/A INTRINSIC
low complexity region 180 201 N/A INTRINSIC
PHD 215 260 5.1e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the inhibitor of growth (ING) family. Members of the ING family associate with and modulate the activity of histone acetyltransferase (HAT) and histone deacetylase (HDAC) complexes and function in DNA repair and apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous inactivation of this gene causes impaired spermatogenesis and male infertility associated with teratozoospermia, seminiferous tubule degeneration, germ cell depletion, arrest of male meiosis and enhanced testicular apoptosis, and leads to an increased incidence of soft tissue sarcomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,968,103 I128V probably benign Het
4930432K21Rik C A 8: 84,166,684 P160Q possibly damaging Het
4931414P19Rik T C 14: 54,595,601 N39S probably benign Het
Abca13 C T 11: 9,621,892 R4818C probably damaging Het
Acadsb A G 7: 131,443,637 I433V probably benign Het
Acsl3 T A 1: 78,688,283 I142N probably benign Het
Api5 G A 2: 94,425,616 T242M probably benign Het
Ccdc88c T C 12: 100,945,064 E37G probably damaging Het
Cntnap4 C A 8: 112,858,242 Q1104K probably benign Het
Cry1 A G 10: 85,148,662 S183P probably benign Het
Cuzd1 A T 7: 131,308,851 F572I probably benign Het
Dcbld1 A T 10: 52,290,889 D104V probably damaging Het
Dhh C T 15: 98,894,026 G367E possibly damaging Het
Dhx15 T C 5: 52,184,589 D129G probably benign Het
Drd3 T A 16: 43,762,498 V86E probably damaging Het
Ebf1 A G 11: 44,621,968 T135A possibly damaging Het
Epha5 T C 5: 84,142,300 I428V probably benign Het
Epx T A 11: 87,875,523 probably benign Het
Fam83d T A 2: 158,785,307 N305K probably benign Het
Gchfr T A 2: 119,169,755 V39D probably benign Het
Ggnbp2 A G 11: 84,860,641 L111P probably damaging Het
Gnal G A 18: 67,222,588 G340D probably damaging Het
Gpat2 A G 2: 127,435,475 E745G probably damaging Het
Gpbp1l1 C T 4: 116,592,848 R438C probably damaging Het
Hmgxb4 C T 8: 75,029,572 Q171* probably null Het
Igkv4-91 G T 6: 68,768,558 R119S possibly damaging Het
Itfg2 A G 6: 128,416,054 V82A probably damaging Het
Klhl22 T C 16: 17,777,026 S340P probably damaging Het
Lipm A T 19: 34,116,471 M263L probably benign Het
Ly96 A T 1: 16,688,563 E19V possibly damaging Het
Mark1 C T 1: 184,912,632 E376K possibly damaging Het
Mlip T A 9: 77,138,553 M375L probably benign Het
Mug1 A T 6: 121,838,714 N26Y probably benign Het
Olfr1032 C T 2: 86,008,595 A273V probably benign Het
Olfr1368 C T 13: 21,143,000 S19N probably benign Het
Olfr543 T A 7: 102,477,850 T7S probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rb1cc1 T C 1: 6,238,466 probably null Het
Rgs4 T C 1: 169,743,767 T178A probably benign Het
Sel1l2 T A 2: 140,340,123 K31N possibly damaging Het
Serpinf1 T C 11: 75,410,196 R398G probably damaging Het
Sgo2b C T 8: 63,940,044 E120K possibly damaging Het
Stard9 T C 2: 120,700,450 F2396S possibly damaging Het
Tcrg-V6 G A 13: 19,190,440 E25K probably benign Het
Trpc3 A C 3: 36,621,310 I893S probably benign Het
Trpc4ap C A 2: 155,692,215 R31L unknown Het
Vat1l A G 8: 114,271,432 R239G possibly damaging Het
Vmn1r56 T A 7: 5,196,262 R119* probably null Het
Vmn2r111 T C 17: 22,571,245 Y260C probably damaging Het
Zfp664 A G 5: 124,886,006 T155A probably benign Het
Other mutations in Ing2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Ing2 APN 8 47669261 missense possibly damaging 0.92
IGL01791:Ing2 APN 8 47669035 missense probably benign 0.02
IGL02477:Ing2 APN 8 47669268 missense possibly damaging 0.95
PIT4418001:Ing2 UTSW 8 47669090 missense probably benign 0.03
R0315:Ing2 UTSW 8 47669090 missense probably benign 0.06
R1793:Ing2 UTSW 8 47669329 missense probably damaging 1.00
R5521:Ing2 UTSW 8 47669213 missense probably damaging 1.00
R5759:Ing2 UTSW 8 47669005 missense possibly damaging 0.71
R5821:Ing2 UTSW 8 47668826 missense probably benign 0.32
R6222:Ing2 UTSW 8 47668931 missense possibly damaging 0.95
R6378:Ing2 UTSW 8 47669258 missense probably benign 0.32
R7243:Ing2 UTSW 8 47674539 missense probably damaging 0.98
R7819:Ing2 UTSW 8 47669028 missense probably damaging 1.00
X0036:Ing2 UTSW 8 47674507 missense probably null 0.94
Predicted Primers PCR Primer
(F):5'- AAACCGATGGCCTTCACTAC -3'
(R):5'- TCCAGTCAACCGGAAAGATC -3'

Sequencing Primer
(F):5'- GATGGCCTTCACTACCTCGC -3'
(R):5'- CCAGTGAGAGCCGTGACTTATGTC -3'
Posted On2019-05-13