Incidental Mutation 'R7031:4930432K21Rik'
ID546329
Institutional Source Beutler Lab
Gene Symbol 4930432K21Rik
Ensembl Gene ENSMUSG00000008129
Gene NameRIKEN cDNA 4930432K21 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R7031 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location84148025-84172590 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 84166684 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 160 (P160Q)
Ref Sequence ENSEMBL: ENSMUSP00000113651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093375] [ENSMUST00000118856] [ENSMUST00000143833]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093375
AA Change: P125Q

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000091067
Gene: ENSMUSG00000008129
AA Change: P125Q

DomainStartEndE-ValueType
low complexity region 226 241 N/A INTRINSIC
low complexity region 291 306 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118856
AA Change: P160Q

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113651
Gene: ENSMUSG00000008129
AA Change: P160Q

DomainStartEndE-ValueType
Pfam:DUF4671 1 193 2.1e-62 PFAM
Pfam:DUF4671 181 600 7.3e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143833
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,968,103 I128V probably benign Het
4931414P19Rik T C 14: 54,595,601 N39S probably benign Het
Abca13 C T 11: 9,621,892 R4818C probably damaging Het
Acadsb A G 7: 131,443,637 I433V probably benign Het
Acsl3 T A 1: 78,688,283 I142N probably benign Het
Api5 G A 2: 94,425,616 T242M probably benign Het
Ccdc88c T C 12: 100,945,064 E37G probably damaging Het
Cntnap4 C A 8: 112,858,242 Q1104K probably benign Het
Cry1 A G 10: 85,148,662 S183P probably benign Het
Cuzd1 A T 7: 131,308,851 F572I probably benign Het
Dcbld1 A T 10: 52,290,889 D104V probably damaging Het
Dhh C T 15: 98,894,026 G367E possibly damaging Het
Dhx15 T C 5: 52,184,589 D129G probably benign Het
Drd3 T A 16: 43,762,498 V86E probably damaging Het
Ebf1 A G 11: 44,621,968 T135A possibly damaging Het
Epha5 T C 5: 84,142,300 I428V probably benign Het
Epx T A 11: 87,875,523 probably benign Het
Fam83d T A 2: 158,785,307 N305K probably benign Het
Gchfr T A 2: 119,169,755 V39D probably benign Het
Ggnbp2 A G 11: 84,860,641 L111P probably damaging Het
Gnal G A 18: 67,222,588 G340D probably damaging Het
Gpat2 A G 2: 127,435,475 E745G probably damaging Het
Gpbp1l1 C T 4: 116,592,848 R438C probably damaging Het
Hmgxb4 C T 8: 75,029,572 Q171* probably null Het
Igkv4-91 G T 6: 68,768,558 R119S possibly damaging Het
Ing2 T C 8: 47,668,823 D230G probably benign Het
Itfg2 A G 6: 128,416,054 V82A probably damaging Het
Klhl22 T C 16: 17,777,026 S340P probably damaging Het
Lipm A T 19: 34,116,471 M263L probably benign Het
Ly96 A T 1: 16,688,563 E19V possibly damaging Het
Mark1 C T 1: 184,912,632 E376K possibly damaging Het
Mlip T A 9: 77,138,553 M375L probably benign Het
Mug1 A T 6: 121,838,714 N26Y probably benign Het
Olfr1032 C T 2: 86,008,595 A273V probably benign Het
Olfr1368 C T 13: 21,143,000 S19N probably benign Het
Olfr543 T A 7: 102,477,850 T7S probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rb1cc1 T C 1: 6,238,466 probably null Het
Rgs4 T C 1: 169,743,767 T178A probably benign Het
Sel1l2 T A 2: 140,340,123 K31N possibly damaging Het
Serpinf1 T C 11: 75,410,196 R398G probably damaging Het
Sgo2b C T 8: 63,940,044 E120K possibly damaging Het
Stard9 T C 2: 120,700,450 F2396S possibly damaging Het
Tcrg-V6 G A 13: 19,190,440 E25K probably benign Het
Trpc3 A C 3: 36,621,310 I893S probably benign Het
Trpc4ap C A 2: 155,692,215 R31L unknown Het
Vat1l A G 8: 114,271,432 R239G possibly damaging Het
Vmn1r56 T A 7: 5,196,262 R119* probably null Het
Vmn2r111 T C 17: 22,571,245 Y260C probably damaging Het
Zfp664 A G 5: 124,886,006 T155A probably benign Het
Other mutations in 4930432K21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:4930432K21Rik APN 8 84166771 missense probably damaging 0.99
IGL00964:4930432K21Rik APN 8 84166714 missense probably benign 0.07
IGL01826:4930432K21Rik APN 8 84166672 missense probably benign 0.03
IGL02445:4930432K21Rik APN 8 84159508 missense probably benign 0.13
R0113:4930432K21Rik UTSW 8 84167242 missense probably damaging 1.00
R1479:4930432K21Rik UTSW 8 84162397 missense possibly damaging 0.59
R1590:4930432K21Rik UTSW 8 84167086 missense probably benign 0.28
R3011:4930432K21Rik UTSW 8 84166910 nonsense probably null
R4357:4930432K21Rik UTSW 8 84159592 missense probably benign 0.25
R5642:4930432K21Rik UTSW 8 84167485 missense probably damaging 0.99
R5664:4930432K21Rik UTSW 8 84166659 missense probably benign 0.25
R5722:4930432K21Rik UTSW 8 84171844 missense probably damaging 0.96
R7224:4930432K21Rik UTSW 8 84172213 missense probably benign
R7303:4930432K21Rik UTSW 8 84161233 missense probably benign 0.38
R7459:4930432K21Rik UTSW 8 84167352 missense probably benign 0.03
R7618:4930432K21Rik UTSW 8 84166870 missense possibly damaging 0.85
RF040:4930432K21Rik UTSW 8 84167575 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CTGATCTTGAGGACGGGATC -3'
(R):5'- AATGCTGATGTGTAGAGGATGTCC -3'

Sequencing Primer
(F):5'- CAACTAGGAAATCTCCAACTAGAAAG -3'
(R):5'- GGGTTCCCCAGAATGCTG -3'
Posted On2019-05-13