Incidental Mutation 'R7031:Mlip'
ID546332
Institutional Source Beutler Lab
Gene Symbol Mlip
Ensembl Gene ENSMUSG00000032355
Gene Namemuscular LMNA-interacting protein
Synonyms2310046A06Rik, CIP, cardiac ISL1-interacting protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R7031 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location77102081-77352969 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 77138553 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 375 (M375L)
Ref Sequence ENSEMBL: ENSMUSP00000139251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034910] [ENSMUST00000183686] [ENSMUST00000183955] [ENSMUST00000184322] [ENSMUST00000184415] [ENSMUST00000184848] [ENSMUST00000185039] [ENSMUST00000185144]
Predicted Effect probably benign
Transcript: ENSMUST00000034910
SMART Domains Protein: ENSMUSP00000034910
Gene: ENSMUSG00000032355

DomainStartEndE-ValueType
Pfam:MLIP 69 155 1.3e-24 PFAM
Pfam:MLIP 175 269 1.9e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183686
Predicted Effect probably benign
Transcript: ENSMUST00000183955
AA Change: M882L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000138864
Gene: ENSMUSG00000032355
AA Change: M882L

DomainStartEndE-ValueType
Pfam:MLIP 111 210 7.6e-37 PFAM
low complexity region 351 363 N/A INTRINSIC
low complexity region 375 387 N/A INTRINSIC
low complexity region 419 430 N/A INTRINSIC
low complexity region 437 455 N/A INTRINSIC
low complexity region 528 541 N/A INTRINSIC
low complexity region 636 651 N/A INTRINSIC
Pfam:MLIP 654 881 8.5e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184322
SMART Domains Protein: ENSMUSP00000139055
Gene: ENSMUSG00000032355

DomainStartEndE-ValueType
Pfam:MLIP 59 149 5.3e-37 PFAM
low complexity region 274 286 N/A INTRINSIC
low complexity region 298 310 N/A INTRINSIC
low complexity region 342 353 N/A INTRINSIC
low complexity region 360 378 N/A INTRINSIC
low complexity region 451 464 N/A INTRINSIC
low complexity region 559 574 N/A INTRINSIC
Pfam:MLIP 577 683 5.8e-23 PFAM
Pfam:MLIP 681 775 6.5e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184415
AA Change: M375L

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000139251
Gene: ENSMUSG00000032355
AA Change: M375L

DomainStartEndE-ValueType
Pfam:MLIP 119 374 1.1e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184848
SMART Domains Protein: ENSMUSP00000139242
Gene: ENSMUSG00000032355

DomainStartEndE-ValueType
Pfam:MLIP 67 154 3.7e-38 PFAM
Pfam:MLIP 153 227 5.4e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185039
SMART Domains Protein: ENSMUSP00000139109
Gene: ENSMUSG00000032355

DomainStartEndE-ValueType
Pfam:MLIP 119 207 3.9e-38 PFAM
Pfam:MLIP 205 279 6.4e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185144
SMART Domains Protein: ENSMUSP00000139362
Gene: ENSMUSG00000032355

DomainStartEndE-ValueType
Pfam:MLIP 67 166 6.3e-37 PFAM
low complexity region 307 319 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
low complexity region 375 386 N/A INTRINSIC
low complexity region 393 411 N/A INTRINSIC
low complexity region 484 497 N/A INTRINSIC
low complexity region 592 607 N/A INTRINSIC
Pfam:MLIP 609 836 4.7e-102 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display increased cardiac sensitivity to induced stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,968,103 I128V probably benign Het
4930432K21Rik C A 8: 84,166,684 P160Q possibly damaging Het
4931414P19Rik T C 14: 54,595,601 N39S probably benign Het
Abca13 C T 11: 9,621,892 R4818C probably damaging Het
Acadsb A G 7: 131,443,637 I433V probably benign Het
Acsl3 T A 1: 78,688,283 I142N probably benign Het
Api5 G A 2: 94,425,616 T242M probably benign Het
Ccdc88c T C 12: 100,945,064 E37G probably damaging Het
Cntnap4 C A 8: 112,858,242 Q1104K probably benign Het
Cry1 A G 10: 85,148,662 S183P probably benign Het
Cuzd1 A T 7: 131,308,851 F572I probably benign Het
Dcbld1 A T 10: 52,290,889 D104V probably damaging Het
Dhh C T 15: 98,894,026 G367E possibly damaging Het
Dhx15 T C 5: 52,184,589 D129G probably benign Het
Drd3 T A 16: 43,762,498 V86E probably damaging Het
Ebf1 A G 11: 44,621,968 T135A possibly damaging Het
Epha5 T C 5: 84,142,300 I428V probably benign Het
Epx T A 11: 87,875,523 probably benign Het
Fam83d T A 2: 158,785,307 N305K probably benign Het
Gchfr T A 2: 119,169,755 V39D probably benign Het
Ggnbp2 A G 11: 84,860,641 L111P probably damaging Het
Gnal G A 18: 67,222,588 G340D probably damaging Het
Gpat2 A G 2: 127,435,475 E745G probably damaging Het
Gpbp1l1 C T 4: 116,592,848 R438C probably damaging Het
Hmgxb4 C T 8: 75,029,572 Q171* probably null Het
Igkv4-91 G T 6: 68,768,558 R119S possibly damaging Het
Ing2 T C 8: 47,668,823 D230G probably benign Het
Itfg2 A G 6: 128,416,054 V82A probably damaging Het
Klhl22 T C 16: 17,777,026 S340P probably damaging Het
Lipm A T 19: 34,116,471 M263L probably benign Het
Ly96 A T 1: 16,688,563 E19V possibly damaging Het
Mark1 C T 1: 184,912,632 E376K possibly damaging Het
Mug1 A T 6: 121,838,714 N26Y probably benign Het
Olfr1032 C T 2: 86,008,595 A273V probably benign Het
Olfr1368 C T 13: 21,143,000 S19N probably benign Het
Olfr543 T A 7: 102,477,850 T7S probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rb1cc1 T C 1: 6,238,466 probably null Het
Rgs4 T C 1: 169,743,767 T178A probably benign Het
Sel1l2 T A 2: 140,340,123 K31N possibly damaging Het
Serpinf1 T C 11: 75,410,196 R398G probably damaging Het
Sgo2b C T 8: 63,940,044 E120K possibly damaging Het
Stard9 T C 2: 120,700,450 F2396S possibly damaging Het
Tcrg-V6 G A 13: 19,190,440 E25K probably benign Het
Trpc3 A C 3: 36,621,310 I893S probably benign Het
Trpc4ap C A 2: 155,692,215 R31L unknown Het
Vat1l A G 8: 114,271,432 R239G possibly damaging Het
Vmn1r56 T A 7: 5,196,262 R119* probably null Het
Vmn2r111 T C 17: 22,571,245 Y260C probably damaging Het
Zfp664 A G 5: 124,886,006 T155A probably benign Het
Other mutations in Mlip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Mlip APN 9 77239417 missense possibly damaging 0.89
IGL01727:Mlip APN 9 77239748 missense probably damaging 0.99
IGL01918:Mlip APN 9 77173999 missense probably damaging 1.00
IGL02079:Mlip APN 9 77239529 missense possibly damaging 0.71
IGL02561:Mlip APN 9 77181351 critical splice donor site probably null
R0393:Mlip UTSW 9 77239577 missense probably benign 0.02
R2091:Mlip UTSW 9 77164863 missense possibly damaging 0.58
R3725:Mlip UTSW 9 77190380 missense probably damaging 1.00
R5334:Mlip UTSW 9 77243676 missense probably damaging 1.00
R5591:Mlip UTSW 9 77230482 missense probably damaging 0.96
R5592:Mlip UTSW 9 77230482 missense probably damaging 0.96
R5686:Mlip UTSW 9 77347693 critical splice donor site probably null
R5820:Mlip UTSW 9 77230482 missense probably damaging 0.96
R6125:Mlip UTSW 9 77230482 missense probably damaging 0.96
R6187:Mlip UTSW 9 77230482 missense probably damaging 0.96
R6803:Mlip UTSW 9 77190381 missense probably damaging 0.99
R6860:Mlip UTSW 9 77102393 makesense probably null
R7206:Mlip UTSW 9 77164862 missense probably damaging 0.96
R7326:Mlip UTSW 9 77164842 missense probably benign 0.24
R7506:Mlip UTSW 9 77164803 missense probably damaging 1.00
R7509:Mlip UTSW 9 77181396 missense probably damaging 0.99
R7563:Mlip UTSW 9 77112997 missense probably damaging 0.99
R7590:Mlip UTSW 9 77230043 missense probably benign 0.15
R7615:Mlip UTSW 9 77230483 missense probably damaging 1.00
R7664:Mlip UTSW 9 77138546 missense possibly damaging 0.90
R7755:Mlip UTSW 9 77229556 missense probably benign 0.30
R8110:Mlip UTSW 9 77239579 missense probably damaging 0.97
R8432:Mlip UTSW 9 77190729 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TATGTGTCCTGACTAAGAAGAGTGG -3'
(R):5'- GTTGCAAGCCTCTGTTTTGC -3'

Sequencing Primer
(F):5'- CTAAGAAGAGTGGGGGATTTCTCC -3'
(R):5'- AGCCTCTGTTTTGCTTGCAGAAAAG -3'
Posted On2019-05-13