Incidental Mutation 'R7031:Dcbld1'
ID546333
Institutional Source Beutler Lab
Gene Symbol Dcbld1
Ensembl Gene ENSMUSG00000019891
Gene Namediscoidin, CUB and LCCL domain containing 1
Synonyms4631413K11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7031 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location52233619-52321378 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 52290889 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 104 (D104V)
Ref Sequence ENSEMBL: ENSMUSP00000151265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069004] [ENSMUST00000218582]
Predicted Effect probably damaging
Transcript: ENSMUST00000069004
AA Change: D175V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000068203
Gene: ENSMUSG00000019891
AA Change: D175V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
CUB 32 141 6.42e-23 SMART
Pfam:LCCL 147 239 4.5e-19 PFAM
transmembrane domain 248 270 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000218582
AA Change: D104V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,968,103 I128V probably benign Het
4930432K21Rik C A 8: 84,166,684 P160Q possibly damaging Het
4931414P19Rik T C 14: 54,595,601 N39S probably benign Het
Abca13 C T 11: 9,621,892 R4818C probably damaging Het
Acadsb A G 7: 131,443,637 I433V probably benign Het
Acsl3 T A 1: 78,688,283 I142N probably benign Het
Api5 G A 2: 94,425,616 T242M probably benign Het
Ccdc88c T C 12: 100,945,064 E37G probably damaging Het
Cntnap4 C A 8: 112,858,242 Q1104K probably benign Het
Cry1 A G 10: 85,148,662 S183P probably benign Het
Cuzd1 A T 7: 131,308,851 F572I probably benign Het
Dhh C T 15: 98,894,026 G367E possibly damaging Het
Dhx15 T C 5: 52,184,589 D129G probably benign Het
Drd3 T A 16: 43,762,498 V86E probably damaging Het
Ebf1 A G 11: 44,621,968 T135A possibly damaging Het
Epha5 T C 5: 84,142,300 I428V probably benign Het
Epx T A 11: 87,875,523 probably benign Het
Fam83d T A 2: 158,785,307 N305K probably benign Het
Gchfr T A 2: 119,169,755 V39D probably benign Het
Ggnbp2 A G 11: 84,860,641 L111P probably damaging Het
Gnal G A 18: 67,222,588 G340D probably damaging Het
Gpat2 A G 2: 127,435,475 E745G probably damaging Het
Gpbp1l1 C T 4: 116,592,848 R438C probably damaging Het
Hmgxb4 C T 8: 75,029,572 Q171* probably null Het
Igkv4-91 G T 6: 68,768,558 R119S possibly damaging Het
Ing2 T C 8: 47,668,823 D230G probably benign Het
Itfg2 A G 6: 128,416,054 V82A probably damaging Het
Klhl22 T C 16: 17,777,026 S340P probably damaging Het
Lipm A T 19: 34,116,471 M263L probably benign Het
Ly96 A T 1: 16,688,563 E19V possibly damaging Het
Mark1 C T 1: 184,912,632 E376K possibly damaging Het
Mlip T A 9: 77,138,553 M375L probably benign Het
Mug1 A T 6: 121,838,714 N26Y probably benign Het
Olfr1032 C T 2: 86,008,595 A273V probably benign Het
Olfr1368 C T 13: 21,143,000 S19N probably benign Het
Olfr543 T A 7: 102,477,850 T7S probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rb1cc1 T C 1: 6,238,466 probably null Het
Rgs4 T C 1: 169,743,767 T178A probably benign Het
Sel1l2 T A 2: 140,340,123 K31N possibly damaging Het
Serpinf1 T C 11: 75,410,196 R398G probably damaging Het
Sgo2b C T 8: 63,940,044 E120K possibly damaging Het
Stard9 T C 2: 120,700,450 F2396S possibly damaging Het
Tcrg-V6 G A 13: 19,190,440 E25K probably benign Het
Trpc3 A C 3: 36,621,310 I893S probably benign Het
Trpc4ap C A 2: 155,692,215 R31L unknown Het
Vat1l A G 8: 114,271,432 R239G possibly damaging Het
Vmn1r56 T A 7: 5,196,262 R119* probably null Het
Vmn2r111 T C 17: 22,571,245 Y260C probably damaging Het
Zfp664 A G 5: 124,886,006 T155A probably benign Het
Other mutations in Dcbld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Dcbld1 APN 10 52312849 missense probably benign
IGL01974:Dcbld1 APN 10 52304681 missense probably benign 0.00
IGL01997:Dcbld1 APN 10 52317110 missense probably damaging 0.98
IGL02811:Dcbld1 APN 10 52319973 missense probably benign
IGL03011:Dcbld1 APN 10 52284148 missense probably damaging 0.98
IGL03329:Dcbld1 APN 10 52319625 missense probably damaging 0.99
IGL03048:Dcbld1 UTSW 10 52304626 missense probably damaging 1.00
R0392:Dcbld1 UTSW 10 52317134 missense possibly damaging 0.92
R0532:Dcbld1 UTSW 10 52317077 missense probably benign 0.06
R0561:Dcbld1 UTSW 10 52261936 missense probably benign 0.02
R0625:Dcbld1 UTSW 10 52312850 missense probably benign 0.38
R0907:Dcbld1 UTSW 10 52261814 missense possibly damaging 0.83
R1567:Dcbld1 UTSW 10 52319656 missense probably damaging 1.00
R1791:Dcbld1 UTSW 10 52319476 missense probably damaging 0.99
R1915:Dcbld1 UTSW 10 52317035 missense probably damaging 0.98
R1921:Dcbld1 UTSW 10 52319651 missense possibly damaging 0.94
R2119:Dcbld1 UTSW 10 52319979 missense probably benign
R2163:Dcbld1 UTSW 10 52286356 missense probably damaging 1.00
R2520:Dcbld1 UTSW 10 52319545 missense probably damaging 0.99
R3196:Dcbld1 UTSW 10 52319491 missense probably damaging 0.99
R3788:Dcbld1 UTSW 10 52319658 missense probably damaging 1.00
R4797:Dcbld1 UTSW 10 52284127 missense probably damaging 0.99
R4904:Dcbld1 UTSW 10 52319970 nonsense probably null
R5177:Dcbld1 UTSW 10 52304634 missense probably damaging 1.00
R5329:Dcbld1 UTSW 10 52284257 intron probably benign
R5456:Dcbld1 UTSW 10 52314390 missense probably damaging 1.00
R6151:Dcbld1 UTSW 10 52304660 missense probably damaging 1.00
R6267:Dcbld1 UTSW 10 52319480 nonsense probably null
R6421:Dcbld1 UTSW 10 52286354 missense probably damaging 1.00
R7738:Dcbld1 UTSW 10 52312826 missense possibly damaging 0.71
R7993:Dcbld1 UTSW 10 52261788 nonsense probably null
R8728:Dcbld1 UTSW 10 52233833 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTTAGATCCAAACCCCTGCC -3'
(R):5'- TACTCCTATTTGGAAATGCTGGAAG -3'

Sequencing Primer
(F):5'- TTCCTTGAACTCAGGATCCATC -3'
(R):5'- TTTGGAAATGCTGGAAGTAAAAATG -3'
Posted On2019-05-13