Incidental Mutation 'R7031:Cry1'
ID546334
Institutional Source Beutler Lab
Gene Symbol Cry1
Ensembl Gene ENSMUSG00000020038
Gene Namecryptochrome 1 (photolyase-like)
SynonymsPhll1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7031 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location85131700-85185064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85148662 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 183 (S183P)
Ref Sequence ENSEMBL: ENSMUSP00000020227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020227]
PDB Structure Crystal Structure of Mouse Cryptochrome1 in Complex with Period2 [X-RAY DIFFRACTION]
Crystal structure of mouse Cryptochrome 1 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000020227
AA Change: S183P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000020227
Gene: ENSMUSG00000020038
AA Change: S183P

DomainStartEndE-ValueType
Pfam:DNA_photolyase 5 168 1.4e-47 PFAM
Pfam:FAD_binding_7 213 486 6.9e-91 PFAM
internal_repeat_1 502 523 3.57e-8 PROSPERO
internal_repeat_1 521 543 3.57e-8 PROSPERO
low complexity region 544 555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214675
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a flavin adenine dinucleotide-binding protein that is a key component of the circadian core oscillator complex, which regulates the circadian clock. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene have been associated with altered sleep patterns. The encoded protein is widely conserved across plants and animals. Loss of this gene results in a shortened circadian cycle in complete darkness. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a one-hour shorter circadian period under constant darkness and reduced expression of another circadian gene in the suprachiasmatic nucleus in response to acute light exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,968,103 I128V probably benign Het
4930432K21Rik C A 8: 84,166,684 P160Q possibly damaging Het
4931414P19Rik T C 14: 54,595,601 N39S probably benign Het
Abca13 C T 11: 9,621,892 R4818C probably damaging Het
Acadsb A G 7: 131,443,637 I433V probably benign Het
Acsl3 T A 1: 78,688,283 I142N probably benign Het
Api5 G A 2: 94,425,616 T242M probably benign Het
Ccdc88c T C 12: 100,945,064 E37G probably damaging Het
Cntnap4 C A 8: 112,858,242 Q1104K probably benign Het
Cuzd1 A T 7: 131,308,851 F572I probably benign Het
Dcbld1 A T 10: 52,290,889 D104V probably damaging Het
Dhh C T 15: 98,894,026 G367E possibly damaging Het
Dhx15 T C 5: 52,184,589 D129G probably benign Het
Drd3 T A 16: 43,762,498 V86E probably damaging Het
Ebf1 A G 11: 44,621,968 T135A possibly damaging Het
Epha5 T C 5: 84,142,300 I428V probably benign Het
Epx T A 11: 87,875,523 probably benign Het
Fam83d T A 2: 158,785,307 N305K probably benign Het
Gchfr T A 2: 119,169,755 V39D probably benign Het
Ggnbp2 A G 11: 84,860,641 L111P probably damaging Het
Gnal G A 18: 67,222,588 G340D probably damaging Het
Gpat2 A G 2: 127,435,475 E745G probably damaging Het
Gpbp1l1 C T 4: 116,592,848 R438C probably damaging Het
Hmgxb4 C T 8: 75,029,572 Q171* probably null Het
Igkv4-91 G T 6: 68,768,558 R119S possibly damaging Het
Ing2 T C 8: 47,668,823 D230G probably benign Het
Itfg2 A G 6: 128,416,054 V82A probably damaging Het
Klhl22 T C 16: 17,777,026 S340P probably damaging Het
Lipm A T 19: 34,116,471 M263L probably benign Het
Ly96 A T 1: 16,688,563 E19V possibly damaging Het
Mark1 C T 1: 184,912,632 E376K possibly damaging Het
Mlip T A 9: 77,138,553 M375L probably benign Het
Mug1 A T 6: 121,838,714 N26Y probably benign Het
Olfr1032 C T 2: 86,008,595 A273V probably benign Het
Olfr1368 C T 13: 21,143,000 S19N probably benign Het
Olfr543 T A 7: 102,477,850 T7S probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rb1cc1 T C 1: 6,238,466 probably null Het
Rgs4 T C 1: 169,743,767 T178A probably benign Het
Sel1l2 T A 2: 140,340,123 K31N possibly damaging Het
Serpinf1 T C 11: 75,410,196 R398G probably damaging Het
Sgo2b C T 8: 63,940,044 E120K possibly damaging Het
Stard9 T C 2: 120,700,450 F2396S possibly damaging Het
Tcrg-V6 G A 13: 19,190,440 E25K probably benign Het
Trpc3 A C 3: 36,621,310 I893S probably benign Het
Trpc4ap C A 2: 155,692,215 R31L unknown Het
Vat1l A G 8: 114,271,432 R239G possibly damaging Het
Vmn1r56 T A 7: 5,196,262 R119* probably null Het
Vmn2r111 T C 17: 22,571,245 Y260C probably damaging Het
Zfp664 A G 5: 124,886,006 T155A probably benign Het
Other mutations in Cry1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Cry1 APN 10 85146834 missense probably benign 0.11
IGL00737:Cry1 APN 10 85143040 missense probably benign 0.02
IGL01349:Cry1 APN 10 85148739 missense probably benign 0.00
IGL01544:Cry1 APN 10 85146496 nonsense probably null
IGL01545:Cry1 APN 10 85184362 missense possibly damaging 0.94
IGL01767:Cry1 APN 10 85146474 missense probably damaging 1.00
IGL03392:Cry1 APN 10 85157129 missense possibly damaging 0.88
R0119:Cry1 UTSW 10 85133240 critical splice donor site probably null
R0605:Cry1 UTSW 10 85184359 missense probably damaging 0.96
R1618:Cry1 UTSW 10 85146454 missense probably damaging 1.00
R1955:Cry1 UTSW 10 85144178 missense probably benign 0.00
R2209:Cry1 UTSW 10 85146755 missense probably damaging 0.98
R2221:Cry1 UTSW 10 85143753 missense probably damaging 1.00
R2223:Cry1 UTSW 10 85143753 missense probably damaging 1.00
R2314:Cry1 UTSW 10 85133311 missense probably benign 0.08
R3851:Cry1 UTSW 10 85146499 missense probably benign 0.15
R3872:Cry1 UTSW 10 85133160 critical splice acceptor site probably null
R3981:Cry1 UTSW 10 85146592 missense probably damaging 0.99
R4856:Cry1 UTSW 10 85148770 missense probably damaging 0.97
R5162:Cry1 UTSW 10 85133286 missense probably benign
R5404:Cry1 UTSW 10 85184419 missense probably damaging 1.00
R5449:Cry1 UTSW 10 85133135 missense probably benign 0.17
R5484:Cry1 UTSW 10 85146724 splice site probably null
R5599:Cry1 UTSW 10 85144250 missense probably benign 0.14
R5717:Cry1 UTSW 10 85146416 missense probably damaging 1.00
R7371:Cry1 UTSW 10 85147919 missense probably benign 0.03
R7943:Cry1 UTSW 10 85143120 missense probably benign 0.03
R8022:Cry1 UTSW 10 85146402 missense probably damaging 0.97
R8290:Cry1 UTSW 10 85143113 nonsense probably null
R8805:Cry1 UTSW 10 85157105 missense probably benign 0.09
Z1176:Cry1 UTSW 10 85144197 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGTCACAGTTTAAGAATGCACATGAG -3'
(R):5'- GCTTATCAGCCAAGCTATATTAGC -3'

Sequencing Primer
(F):5'- GGGAATTTCACACATCGTATTCTG -3'
(R):5'- TTTCAGACTCTCGTCAGC -3'
Posted On2019-05-13