Incidental Mutation 'R7031:Serpinf1'
ID546337
Institutional Source Beutler Lab
Gene Symbol Serpinf1
Ensembl Gene ENSMUSG00000000753
Gene Nameserine (or cysteine) peptidase inhibitor, clade F, member 1
Synonymsalpha-2 antiplasmin, Pedfl, Pedf, pigment epithelium derived factor, EPC-1, Sdf3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R7031 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location75409769-75422701 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75410196 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 398 (R398G)
Ref Sequence ENSEMBL: ENSMUSP00000000769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000769] [ENSMUST00000044530] [ENSMUST00000137103] [ENSMUST00000138661] [ENSMUST00000168902]
Predicted Effect probably damaging
Transcript: ENSMUST00000000769
AA Change: R398G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000769
Gene: ENSMUSG00000000753
AA Change: R398G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SERPIN 62 414 5.22e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000044530
SMART Domains Protein: ENSMUSP00000047505
Gene: ENSMUSG00000018809

DomainStartEndE-ValueType
Pfam:TPR_11 65 132 2.4e-10 PFAM
SET 231 576 4.85e-1 SMART
Blast:TPR 694 726 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000137103
SMART Domains Protein: ENSMUSP00000114761
Gene: ENSMUSG00000000753

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SERPIN 62 210 7.93e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138661
SMART Domains Protein: ENSMUSP00000121180
Gene: ENSMUSG00000000753

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SERPIN 62 205 1.47e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167281
SMART Domains Protein: ENSMUSP00000133230
Gene: ENSMUSG00000000753

DomainStartEndE-ValueType
Pfam:Serpin 1 122 7.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168902
SMART Domains Protein: ENSMUSP00000131043
Gene: ENSMUSG00000000753

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serpin family that does not display the serine protease inhibitory activity shown by many of the other serpin proteins. The encoded protein is secreted and strongly inhibits angiogenesis. In addition, this protein is a neurotrophic factor involved in neuronal differentiation in retinoblastoma cells. Mutations in this gene were found in individuals with osteogenesis imperfecta, type VI. [provided by RefSeq, Aug 2016]
PHENOTYPE: Loss of function results in increased microvasculature, pancreatic enlargement, and prostatic hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,968,103 I128V probably benign Het
4930432K21Rik C A 8: 84,166,684 P160Q possibly damaging Het
4931414P19Rik T C 14: 54,595,601 N39S probably benign Het
Abca13 C T 11: 9,621,892 R4818C probably damaging Het
Acadsb A G 7: 131,443,637 I433V probably benign Het
Acsl3 T A 1: 78,688,283 I142N probably benign Het
Api5 G A 2: 94,425,616 T242M probably benign Het
Ccdc88c T C 12: 100,945,064 E37G probably damaging Het
Cntnap4 C A 8: 112,858,242 Q1104K probably benign Het
Cry1 A G 10: 85,148,662 S183P probably benign Het
Cuzd1 A T 7: 131,308,851 F572I probably benign Het
Dcbld1 A T 10: 52,290,889 D104V probably damaging Het
Dhh C T 15: 98,894,026 G367E possibly damaging Het
Dhx15 T C 5: 52,184,589 D129G probably benign Het
Drd3 T A 16: 43,762,498 V86E probably damaging Het
Ebf1 A G 11: 44,621,968 T135A possibly damaging Het
Epha5 T C 5: 84,142,300 I428V probably benign Het
Epx T A 11: 87,875,523 probably benign Het
Fam83d T A 2: 158,785,307 N305K probably benign Het
Gchfr T A 2: 119,169,755 V39D probably benign Het
Ggnbp2 A G 11: 84,860,641 L111P probably damaging Het
Gnal G A 18: 67,222,588 G340D probably damaging Het
Gpat2 A G 2: 127,435,475 E745G probably damaging Het
Gpbp1l1 C T 4: 116,592,848 R438C probably damaging Het
Hmgxb4 C T 8: 75,029,572 Q171* probably null Het
Igkv4-91 G T 6: 68,768,558 R119S possibly damaging Het
Ing2 T C 8: 47,668,823 D230G probably benign Het
Itfg2 A G 6: 128,416,054 V82A probably damaging Het
Klhl22 T C 16: 17,777,026 S340P probably damaging Het
Lipm A T 19: 34,116,471 M263L probably benign Het
Ly96 A T 1: 16,688,563 E19V possibly damaging Het
Mark1 C T 1: 184,912,632 E376K possibly damaging Het
Mlip T A 9: 77,138,553 M375L probably benign Het
Mug1 A T 6: 121,838,714 N26Y probably benign Het
Olfr1032 C T 2: 86,008,595 A273V probably benign Het
Olfr1368 C T 13: 21,143,000 S19N probably benign Het
Olfr543 T A 7: 102,477,850 T7S probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rb1cc1 T C 1: 6,238,466 probably null Het
Rgs4 T C 1: 169,743,767 T178A probably benign Het
Sel1l2 T A 2: 140,340,123 K31N possibly damaging Het
Sgo2b C T 8: 63,940,044 E120K possibly damaging Het
Stard9 T C 2: 120,700,450 F2396S possibly damaging Het
Tcrg-V6 G A 13: 19,190,440 E25K probably benign Het
Trpc3 A C 3: 36,621,310 I893S probably benign Het
Trpc4ap C A 2: 155,692,215 R31L unknown Het
Vat1l A G 8: 114,271,432 R239G possibly damaging Het
Vmn1r56 T A 7: 5,196,262 R119* probably null Het
Vmn2r111 T C 17: 22,571,245 Y260C probably damaging Het
Zfp664 A G 5: 124,886,006 T155A probably benign Het
Other mutations in Serpinf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
clenched UTSW 11 75413905 critical splice donor site probably null
R0306:Serpinf1 UTSW 11 75413935 missense probably damaging 1.00
R0379:Serpinf1 UTSW 11 75413945 missense probably benign 0.25
R1588:Serpinf1 UTSW 11 75410250 missense probably damaging 0.99
R1720:Serpinf1 UTSW 11 75413981 missense probably null 0.26
R1917:Serpinf1 UTSW 11 75411007 missense possibly damaging 0.72
R1961:Serpinf1 UTSW 11 75416419 missense probably benign 0.01
R4704:Serpinf1 UTSW 11 75411041 missense probably damaging 0.99
R5138:Serpinf1 UTSW 11 75415028 missense probably damaging 1.00
R5618:Serpinf1 UTSW 11 75410184 missense possibly damaging 0.47
R6327:Serpinf1 UTSW 11 75413905 critical splice donor site probably null
R7171:Serpinf1 UTSW 11 75417985 missense possibly damaging 0.88
R7436:Serpinf1 UTSW 11 75416316 missense probably benign 0.11
R8344:Serpinf1 UTSW 11 75415571 missense unknown
Predicted Primers PCR Primer
(F):5'- CCAGTTTCTCTCCATATGAAACAGC -3'
(R):5'- AGTCGTTGTTTGAATCACCCG -3'

Sequencing Primer
(F):5'- TGAAACAGCTTCAAACAGGAGAAG -3'
(R):5'- CCGACTTCAGCAAGATTACTGG -3'
Posted On2019-05-13