Incidental Mutation 'R7031:Ggnbp2'
ID546338
Institutional Source Beutler Lab
Gene Symbol Ggnbp2
Ensembl Gene ENSMUSG00000020530
Gene Namegametogenetin binding protein 2
SynonymsZfp403, DIF-3, D330017P12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.741) question?
Stock #R7031 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location84832361-84870817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84860641 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 111 (L111P)
Ref Sequence ENSEMBL: ENSMUSP00000018547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018547] [ENSMUST00000100686] [ENSMUST00000108081] [ENSMUST00000154915] [ENSMUST00000166425] [ENSMUST00000168434] [ENSMUST00000170741] [ENSMUST00000172405]
Predicted Effect probably damaging
Transcript: ENSMUST00000018547
AA Change: L111P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018547
Gene: ENSMUSG00000020530
AA Change: L111P

DomainStartEndE-ValueType
low complexity region 179 185 N/A INTRINSIC
coiled coil region 393 426 N/A INTRINSIC
low complexity region 570 584 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100686
AA Change: L111P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000098252
Gene: ENSMUSG00000020530
AA Change: L111P

DomainStartEndE-ValueType
coiled coil region 351 388 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108081
AA Change: L111P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103716
Gene: ENSMUSG00000020530
AA Change: L111P

DomainStartEndE-ValueType
coiled coil region 353 386 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000154915
AA Change: L111P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117482
Gene: ENSMUSG00000020530
AA Change: L111P

DomainStartEndE-ValueType
coiled coil region 351 384 N/A INTRINSIC
low complexity region 528 542 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166425
Predicted Effect probably damaging
Transcript: ENSMUST00000168434
AA Change: L111P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130013
Gene: ENSMUSG00000020530
AA Change: L111P

DomainStartEndE-ValueType
coiled coil region 351 384 N/A INTRINSIC
low complexity region 528 542 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170741
SMART Domains Protein: ENSMUSP00000128109
Gene: ENSMUSG00000020530

DomainStartEndE-ValueType
low complexity region 99 113 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172405
AA Change: L111P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127584
Gene: ENSMUSG00000020530
AA Change: L111P

DomainStartEndE-ValueType
coiled coil region 353 386 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit lethality throughout fetal growth and development associated with pallor and alterations in placental labyrinth vasculature morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,968,103 I128V probably benign Het
4930432K21Rik C A 8: 84,166,684 P160Q possibly damaging Het
4931414P19Rik T C 14: 54,595,601 N39S probably benign Het
Abca13 C T 11: 9,621,892 R4818C probably damaging Het
Acadsb A G 7: 131,443,637 I433V probably benign Het
Acsl3 T A 1: 78,688,283 I142N probably benign Het
Api5 G A 2: 94,425,616 T242M probably benign Het
Ccdc88c T C 12: 100,945,064 E37G probably damaging Het
Cntnap4 C A 8: 112,858,242 Q1104K probably benign Het
Cry1 A G 10: 85,148,662 S183P probably benign Het
Cuzd1 A T 7: 131,308,851 F572I probably benign Het
Dcbld1 A T 10: 52,290,889 D104V probably damaging Het
Dhh C T 15: 98,894,026 G367E possibly damaging Het
Dhx15 T C 5: 52,184,589 D129G probably benign Het
Drd3 T A 16: 43,762,498 V86E probably damaging Het
Ebf1 A G 11: 44,621,968 T135A possibly damaging Het
Epha5 T C 5: 84,142,300 I428V probably benign Het
Epx T A 11: 87,875,523 probably benign Het
Fam83d T A 2: 158,785,307 N305K probably benign Het
Gchfr T A 2: 119,169,755 V39D probably benign Het
Gnal G A 18: 67,222,588 G340D probably damaging Het
Gpat2 A G 2: 127,435,475 E745G probably damaging Het
Gpbp1l1 C T 4: 116,592,848 R438C probably damaging Het
Hmgxb4 C T 8: 75,029,572 Q171* probably null Het
Igkv4-91 G T 6: 68,768,558 R119S possibly damaging Het
Ing2 T C 8: 47,668,823 D230G probably benign Het
Itfg2 A G 6: 128,416,054 V82A probably damaging Het
Klhl22 T C 16: 17,777,026 S340P probably damaging Het
Lipm A T 19: 34,116,471 M263L probably benign Het
Ly96 A T 1: 16,688,563 E19V possibly damaging Het
Mark1 C T 1: 184,912,632 E376K possibly damaging Het
Mlip T A 9: 77,138,553 M375L probably benign Het
Mug1 A T 6: 121,838,714 N26Y probably benign Het
Olfr1032 C T 2: 86,008,595 A273V probably benign Het
Olfr1368 C T 13: 21,143,000 S19N probably benign Het
Olfr543 T A 7: 102,477,850 T7S probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rb1cc1 T C 1: 6,238,466 probably null Het
Rgs4 T C 1: 169,743,767 T178A probably benign Het
Sel1l2 T A 2: 140,340,123 K31N possibly damaging Het
Serpinf1 T C 11: 75,410,196 R398G probably damaging Het
Sgo2b C T 8: 63,940,044 E120K possibly damaging Het
Stard9 T C 2: 120,700,450 F2396S possibly damaging Het
Tcrg-V6 G A 13: 19,190,440 E25K probably benign Het
Trpc3 A C 3: 36,621,310 I893S probably benign Het
Trpc4ap C A 2: 155,692,215 R31L unknown Het
Vat1l A G 8: 114,271,432 R239G possibly damaging Het
Vmn1r56 T A 7: 5,196,262 R119* probably null Het
Vmn2r111 T C 17: 22,571,245 Y260C probably damaging Het
Zfp664 A G 5: 124,886,006 T155A probably benign Het
Other mutations in Ggnbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Ggnbp2 APN 11 84840404 missense possibly damaging 0.49
IGL02095:Ggnbp2 APN 11 84833128 missense probably damaging 1.00
IGL02366:Ggnbp2 APN 11 84841601 missense probably damaging 1.00
IGL02548:Ggnbp2 APN 11 84862286 missense possibly damaging 0.78
R0211:Ggnbp2 UTSW 11 84840313 missense probably damaging 1.00
R0211:Ggnbp2 UTSW 11 84840313 missense probably damaging 1.00
R0375:Ggnbp2 UTSW 11 84836374 nonsense probably null
R0415:Ggnbp2 UTSW 11 84833225 splice site probably benign
R0433:Ggnbp2 UTSW 11 84836420 missense probably damaging 1.00
R0589:Ggnbp2 UTSW 11 84836451 missense probably damaging 1.00
R0970:Ggnbp2 UTSW 11 84862312 missense possibly damaging 0.83
R1413:Ggnbp2 UTSW 11 84833129 missense probably damaging 1.00
R1912:Ggnbp2 UTSW 11 84862296 missense probably benign 0.02
R1997:Ggnbp2 UTSW 11 84860561 missense probably damaging 1.00
R2161:Ggnbp2 UTSW 11 84834433 missense probably benign 0.08
R2220:Ggnbp2 UTSW 11 84836613 missense possibly damaging 0.46
R2879:Ggnbp2 UTSW 11 84832971 splice site probably null
R2941:Ggnbp2 UTSW 11 84841581 missense probably damaging 1.00
R3726:Ggnbp2 UTSW 11 84854094 missense possibly damaging 0.93
R4662:Ggnbp2 UTSW 11 84862246 missense probably damaging 1.00
R4771:Ggnbp2 UTSW 11 84834488 missense probably benign 0.00
R5212:Ggnbp2 UTSW 11 84854021 intron probably benign
R5310:Ggnbp2 UTSW 11 84869968 start codon destroyed probably null 1.00
R5479:Ggnbp2 UTSW 11 84854343 missense probably benign
R5924:Ggnbp2 UTSW 11 84858537 missense possibly damaging 0.61
R6212:Ggnbp2 UTSW 11 84836677 missense possibly damaging 0.94
R6700:Ggnbp2 UTSW 11 84840105 missense probably damaging 1.00
R6931:Ggnbp2 UTSW 11 84833167 missense probably damaging 1.00
R7493:Ggnbp2 UTSW 11 84854073 missense probably benign 0.21
R7694:Ggnbp2 UTSW 11 84860713 missense possibly damaging 0.94
R7761:Ggnbp2 UTSW 11 84839977 splice site probably null
R8257:Ggnbp2 UTSW 11 84837989 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGTTTCCCCTCATTACAAGGC -3'
(R):5'- GGTTCTTTCCCAAAGATAAAAGCCAAC -3'

Sequencing Primer
(F):5'- ACAAGGCCTATTGTTATCAAGTTG -3'
(R):5'- TTCATTTTTCTTTCTCTCTTTCAGCG -3'
Posted On2019-05-13