Incidental Mutation 'R7031:Ccdc88c'
ID546340
Institutional Source Beutler Lab
Gene Symbol Ccdc88c
Ensembl Gene ENSMUSG00000021182
Gene Namecoiled-coil domain containing 88C
Synonyms0610010D24Rik, Daple
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7031 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location100911523-101029056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100945064 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 37 (E37G)
Ref Sequence ENSEMBL: ENSMUSP00000152316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068411] [ENSMUST00000085096] [ENSMUST00000223235]
Predicted Effect probably damaging
Transcript: ENSMUST00000068411
AA Change: E837G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068629
Gene: ENSMUSG00000021182
AA Change: E837G

DomainStartEndE-ValueType
Pfam:HOOK 7 586 5.9e-37 PFAM
low complexity region 601 613 N/A INTRINSIC
low complexity region 617 634 N/A INTRINSIC
Blast:BRLZ 668 719 3e-8 BLAST
low complexity region 724 744 N/A INTRINSIC
low complexity region 827 837 N/A INTRINSIC
low complexity region 847 866 N/A INTRINSIC
Blast:BRLZ 948 1007 6e-15 BLAST
coiled coil region 1035 1085 N/A INTRINSIC
low complexity region 1095 1110 N/A INTRINSIC
coiled coil region 1129 1252 N/A INTRINSIC
coiled coil region 1312 1384 N/A INTRINSIC
low complexity region 1430 1439 N/A INTRINSIC
low complexity region 1510 1524 N/A INTRINSIC
low complexity region 1562 1583 N/A INTRINSIC
low complexity region 1698 1709 N/A INTRINSIC
internal_repeat_1 1721 1778 6.97e-6 PROSPERO
low complexity region 1788 1808 N/A INTRINSIC
internal_repeat_1 1934 1989 6.97e-6 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000085096
AA Change: E844G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082177
Gene: ENSMUSG00000021182
AA Change: E844G

DomainStartEndE-ValueType
Pfam:HOOK 13 597 2.5e-41 PFAM
low complexity region 608 620 N/A INTRINSIC
low complexity region 624 641 N/A INTRINSIC
Blast:BRLZ 675 726 3e-8 BLAST
low complexity region 731 751 N/A INTRINSIC
low complexity region 834 844 N/A INTRINSIC
low complexity region 854 873 N/A INTRINSIC
Blast:BRLZ 955 1014 5e-15 BLAST
coiled coil region 1042 1092 N/A INTRINSIC
low complexity region 1102 1117 N/A INTRINSIC
coiled coil region 1136 1259 N/A INTRINSIC
coiled coil region 1319 1391 N/A INTRINSIC
low complexity region 1437 1446 N/A INTRINSIC
low complexity region 1517 1531 N/A INTRINSIC
low complexity region 1569 1590 N/A INTRINSIC
low complexity region 1705 1716 N/A INTRINSIC
internal_repeat_1 1728 1785 6.57e-6 PROSPERO
low complexity region 1795 1815 N/A INTRINSIC
internal_repeat_1 1941 1996 6.57e-6 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000223235
AA Change: E37G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed coiled-coil domain-containing protein that interacts with the dishevelled protein and is a negative regulator of the Wnt signalling pathway. The protein encoded by this gene has a PDZ-domain binding motif in its C-terminus with which it interacts with the dishevelled protein. Dishevelled is a scaffold protein involved in the regulation of the Wnt signaling pathway. The Wnt signaling pathway plays an important role in embryonic development, tissue maintenance, and cancer progression. Mutations in this gene cause autosomal recessive, primary non-syndromic congenital hydrocephalus; a condition characterized by excessive accumulation of cerebrospinal fluid in the ventricles of the brain. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,968,103 I128V probably benign Het
4930432K21Rik C A 8: 84,166,684 P160Q possibly damaging Het
4931414P19Rik T C 14: 54,595,601 N39S probably benign Het
Abca13 C T 11: 9,621,892 R4818C probably damaging Het
Acadsb A G 7: 131,443,637 I433V probably benign Het
Acsl3 T A 1: 78,688,283 I142N probably benign Het
Api5 G A 2: 94,425,616 T242M probably benign Het
Cntnap4 C A 8: 112,858,242 Q1104K probably benign Het
Cry1 A G 10: 85,148,662 S183P probably benign Het
Cuzd1 A T 7: 131,308,851 F572I probably benign Het
Dcbld1 A T 10: 52,290,889 D104V probably damaging Het
Dhh C T 15: 98,894,026 G367E possibly damaging Het
Dhx15 T C 5: 52,184,589 D129G probably benign Het
Drd3 T A 16: 43,762,498 V86E probably damaging Het
Ebf1 A G 11: 44,621,968 T135A possibly damaging Het
Epha5 T C 5: 84,142,300 I428V probably benign Het
Epx T A 11: 87,875,523 probably benign Het
Fam83d T A 2: 158,785,307 N305K probably benign Het
Gchfr T A 2: 119,169,755 V39D probably benign Het
Ggnbp2 A G 11: 84,860,641 L111P probably damaging Het
Gnal G A 18: 67,222,588 G340D probably damaging Het
Gpat2 A G 2: 127,435,475 E745G probably damaging Het
Gpbp1l1 C T 4: 116,592,848 R438C probably damaging Het
Hmgxb4 C T 8: 75,029,572 Q171* probably null Het
Igkv4-91 G T 6: 68,768,558 R119S possibly damaging Het
Ing2 T C 8: 47,668,823 D230G probably benign Het
Itfg2 A G 6: 128,416,054 V82A probably damaging Het
Klhl22 T C 16: 17,777,026 S340P probably damaging Het
Lipm A T 19: 34,116,471 M263L probably benign Het
Ly96 A T 1: 16,688,563 E19V possibly damaging Het
Mark1 C T 1: 184,912,632 E376K possibly damaging Het
Mlip T A 9: 77,138,553 M375L probably benign Het
Mug1 A T 6: 121,838,714 N26Y probably benign Het
Olfr1032 C T 2: 86,008,595 A273V probably benign Het
Olfr1368 C T 13: 21,143,000 S19N probably benign Het
Olfr543 T A 7: 102,477,850 T7S probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rb1cc1 T C 1: 6,238,466 probably null Het
Rgs4 T C 1: 169,743,767 T178A probably benign Het
Sel1l2 T A 2: 140,340,123 K31N possibly damaging Het
Serpinf1 T C 11: 75,410,196 R398G probably damaging Het
Sgo2b C T 8: 63,940,044 E120K possibly damaging Het
Stard9 T C 2: 120,700,450 F2396S possibly damaging Het
Tcrg-V6 G A 13: 19,190,440 E25K probably benign Het
Trpc3 A C 3: 36,621,310 I893S probably benign Het
Trpc4ap C A 2: 155,692,215 R31L unknown Het
Vat1l A G 8: 114,271,432 R239G possibly damaging Het
Vmn1r56 T A 7: 5,196,262 R119* probably null Het
Vmn2r111 T C 17: 22,571,245 Y260C probably damaging Het
Zfp664 A G 5: 124,886,006 T155A probably benign Het
Other mutations in Ccdc88c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Ccdc88c APN 12 100916803 missense probably benign 0.04
IGL02016:Ccdc88c APN 12 100941207 missense possibly damaging 0.63
IGL02031:Ccdc88c APN 12 100933311 missense probably damaging 0.98
IGL02133:Ccdc88c APN 12 100940090 missense probably damaging 1.00
IGL02427:Ccdc88c APN 12 100921592 missense probably damaging 1.00
IGL02494:Ccdc88c APN 12 100945475 missense probably benign
IGL02496:Ccdc88c APN 12 100953293 missense probably benign 0.05
IGL02549:Ccdc88c APN 12 100928932 missense probably benign 0.18
IGL02618:Ccdc88c APN 12 100913553 missense probably benign 0.28
IGL02626:Ccdc88c APN 12 100967800 unclassified probably benign
IGL03142:Ccdc88c APN 12 100947198 missense probably damaging 1.00
BB010:Ccdc88c UTSW 12 100945490 missense possibly damaging 0.93
BB020:Ccdc88c UTSW 12 100945490 missense possibly damaging 0.93
R0127:Ccdc88c UTSW 12 100935740 missense possibly damaging 0.88
R0533:Ccdc88c UTSW 12 100954282 missense probably damaging 1.00
R0545:Ccdc88c UTSW 12 100947188 missense probably damaging 1.00
R0866:Ccdc88c UTSW 12 100913192 missense probably benign 0.01
R1230:Ccdc88c UTSW 12 100948488 missense probably benign 0.00
R1434:Ccdc88c UTSW 12 100939166 splice site probably benign
R1614:Ccdc88c UTSW 12 100912984 missense probably benign 0.00
R1644:Ccdc88c UTSW 12 100913474 missense probably damaging 0.98
R1712:Ccdc88c UTSW 12 100939025 missense probably benign 0.14
R2107:Ccdc88c UTSW 12 100921549 missense probably benign
R3612:Ccdc88c UTSW 12 100939073 missense probably damaging 0.99
R3724:Ccdc88c UTSW 12 100930524 missense possibly damaging 0.80
R3737:Ccdc88c UTSW 12 100930524 missense possibly damaging 0.80
R3743:Ccdc88c UTSW 12 100948584 missense probably damaging 1.00
R3772:Ccdc88c UTSW 12 100966100 unclassified probably benign
R3776:Ccdc88c UTSW 12 100947179 missense probably damaging 0.97
R3917:Ccdc88c UTSW 12 100941107 critical splice donor site probably null
R4034:Ccdc88c UTSW 12 100930524 missense possibly damaging 0.80
R4035:Ccdc88c UTSW 12 100930524 missense possibly damaging 0.80
R4110:Ccdc88c UTSW 12 100945073 missense probably damaging 1.00
R4113:Ccdc88c UTSW 12 100945073 missense probably damaging 1.00
R4270:Ccdc88c UTSW 12 100947219 missense probably damaging 1.00
R4271:Ccdc88c UTSW 12 100947219 missense probably damaging 1.00
R4520:Ccdc88c UTSW 12 100913332 missense possibly damaging 0.48
R4521:Ccdc88c UTSW 12 100913332 missense possibly damaging 0.48
R4522:Ccdc88c UTSW 12 100913332 missense possibly damaging 0.48
R4523:Ccdc88c UTSW 12 100913332 missense possibly damaging 0.48
R4524:Ccdc88c UTSW 12 100913332 missense possibly damaging 0.48
R4717:Ccdc88c UTSW 12 100916666 missense probably benign 0.00
R4821:Ccdc88c UTSW 12 100938079 missense probably benign 0.00
R4823:Ccdc88c UTSW 12 100930543 missense probably damaging 1.00
R5090:Ccdc88c UTSW 12 100954180 missense probably damaging 1.00
R5510:Ccdc88c UTSW 12 100945031 missense probably damaging 1.00
R5514:Ccdc88c UTSW 12 100913439 missense probably damaging 1.00
R5903:Ccdc88c UTSW 12 100930542 missense probably damaging 1.00
R5999:Ccdc88c UTSW 12 100968354 missense probably damaging 1.00
R6131:Ccdc88c UTSW 12 100941128 missense probably damaging 1.00
R6164:Ccdc88c UTSW 12 100953383 missense probably damaging 0.98
R6971:Ccdc88c UTSW 12 100954227 missense probably damaging 1.00
R6998:Ccdc88c UTSW 12 100916852 missense probably damaging 0.96
R7240:Ccdc88c UTSW 12 100944939 missense probably benign 0.17
R7366:Ccdc88c UTSW 12 100944950 missense possibly damaging 0.89
R7604:Ccdc88c UTSW 12 100930547 missense probably damaging 1.00
R7674:Ccdc88c UTSW 12 100945232 missense probably benign 0.00
R7795:Ccdc88c UTSW 12 100923311 missense probably benign 0.32
R7933:Ccdc88c UTSW 12 100945490 missense possibly damaging 0.93
R7990:Ccdc88c UTSW 12 100967985 missense probably damaging 1.00
R8339:Ccdc88c UTSW 12 100941140 nonsense probably null
R8734:Ccdc88c UTSW 12 100940135 missense probably damaging 1.00
R8778:Ccdc88c UTSW 12 100945224 missense probably benign 0.25
Z1176:Ccdc88c UTSW 12 100945770 missense possibly damaging 0.69
Z1177:Ccdc88c UTSW 12 100945155 missense probably benign
Z1190:Ccdc88c UTSW 12 100923332 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATGTTGCCATTGCCCAACC -3'
(R):5'- CTTGAGCAAGAAGTCGGAGC -3'

Sequencing Primer
(F):5'- ATTGCCCAACCTCGAGGCTC -3'
(R):5'- TGCAGCACAGCTTGGAG -3'
Posted On2019-05-13