Incidental Mutation 'R7031:4931414P19Rik'
ID546343
Institutional Source Beutler Lab
Gene Symbol 4931414P19Rik
Ensembl Gene ENSMUSG00000022179
Gene NameRIKEN cDNA 4931414P19 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R7031 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location54583663-54605993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54595601 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 39 (N39S)
Ref Sequence ENSEMBL: ENSMUSP00000022786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022786]
Predicted Effect probably benign
Transcript: ENSMUST00000022786
AA Change: N39S

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000022786
Gene: ENSMUSG00000022179
AA Change: N39S

DomainStartEndE-ValueType
Pfam:DUF4616 2 538 1.5e-263 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,968,103 I128V probably benign Het
4930432K21Rik C A 8: 84,166,684 P160Q possibly damaging Het
Abca13 C T 11: 9,621,892 R4818C probably damaging Het
Acadsb A G 7: 131,443,637 I433V probably benign Het
Acsl3 T A 1: 78,688,283 I142N probably benign Het
Api5 G A 2: 94,425,616 T242M probably benign Het
Ccdc88c T C 12: 100,945,064 E37G probably damaging Het
Cntnap4 C A 8: 112,858,242 Q1104K probably benign Het
Cry1 A G 10: 85,148,662 S183P probably benign Het
Cuzd1 A T 7: 131,308,851 F572I probably benign Het
Dcbld1 A T 10: 52,290,889 D104V probably damaging Het
Dhh C T 15: 98,894,026 G367E possibly damaging Het
Dhx15 T C 5: 52,184,589 D129G probably benign Het
Drd3 T A 16: 43,762,498 V86E probably damaging Het
Ebf1 A G 11: 44,621,968 T135A possibly damaging Het
Epha5 T C 5: 84,142,300 I428V probably benign Het
Epx T A 11: 87,875,523 probably benign Het
Fam83d T A 2: 158,785,307 N305K probably benign Het
Gchfr T A 2: 119,169,755 V39D probably benign Het
Ggnbp2 A G 11: 84,860,641 L111P probably damaging Het
Gnal G A 18: 67,222,588 G340D probably damaging Het
Gpat2 A G 2: 127,435,475 E745G probably damaging Het
Gpbp1l1 C T 4: 116,592,848 R438C probably damaging Het
Hmgxb4 C T 8: 75,029,572 Q171* probably null Het
Igkv4-91 G T 6: 68,768,558 R119S possibly damaging Het
Ing2 T C 8: 47,668,823 D230G probably benign Het
Itfg2 A G 6: 128,416,054 V82A probably damaging Het
Klhl22 T C 16: 17,777,026 S340P probably damaging Het
Lipm A T 19: 34,116,471 M263L probably benign Het
Ly96 A T 1: 16,688,563 E19V possibly damaging Het
Mark1 C T 1: 184,912,632 E376K possibly damaging Het
Mlip T A 9: 77,138,553 M375L probably benign Het
Mug1 A T 6: 121,838,714 N26Y probably benign Het
Olfr1032 C T 2: 86,008,595 A273V probably benign Het
Olfr1368 C T 13: 21,143,000 S19N probably benign Het
Olfr543 T A 7: 102,477,850 T7S probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rb1cc1 T C 1: 6,238,466 probably null Het
Rgs4 T C 1: 169,743,767 T178A probably benign Het
Sel1l2 T A 2: 140,340,123 K31N possibly damaging Het
Serpinf1 T C 11: 75,410,196 R398G probably damaging Het
Sgo2b C T 8: 63,940,044 E120K possibly damaging Het
Stard9 T C 2: 120,700,450 F2396S possibly damaging Het
Tcrg-V6 G A 13: 19,190,440 E25K probably benign Het
Trpc3 A C 3: 36,621,310 I893S probably benign Het
Trpc4ap C A 2: 155,692,215 R31L unknown Het
Vat1l A G 8: 114,271,432 R239G possibly damaging Het
Vmn1r56 T A 7: 5,196,262 R119* probably null Het
Vmn2r111 T C 17: 22,571,245 Y260C probably damaging Het
Zfp664 A G 5: 124,886,006 T155A probably benign Het
Other mutations in 4931414P19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:4931414P19Rik APN 14 54595578 missense possibly damaging 0.56
IGL01448:4931414P19Rik APN 14 54585960 missense possibly damaging 0.77
IGL01934:4931414P19Rik APN 14 54585655 missense probably damaging 1.00
IGL02194:4931414P19Rik APN 14 54591355 nonsense probably null
IGL02721:4931414P19Rik APN 14 54585745 missense probably damaging 1.00
IGL03124:4931414P19Rik APN 14 54595139 missense probably benign 0.00
R0575:4931414P19Rik UTSW 14 54591252 missense possibly damaging 0.62
R2049:4931414P19Rik UTSW 14 54584987 nonsense probably null
R3829:4931414P19Rik UTSW 14 54584509 missense probably damaging 1.00
R3876:4931414P19Rik UTSW 14 54591400 nonsense probably null
R4392:4931414P19Rik UTSW 14 54584978 critical splice donor site probably null
R4680:4931414P19Rik UTSW 14 54585076 missense probably damaging 1.00
R4805:4931414P19Rik UTSW 14 54595454 missense probably benign 0.00
R4940:4931414P19Rik UTSW 14 54591325 missense probably benign
R5091:4931414P19Rik UTSW 14 54585711 missense probably damaging 1.00
R5291:4931414P19Rik UTSW 14 54585937 missense probably damaging 1.00
R5594:4931414P19Rik UTSW 14 54584984 missense probably damaging 1.00
R6815:4931414P19Rik UTSW 14 54591153 missense probably damaging 1.00
R7229:4931414P19Rik UTSW 14 54595352 missense probably benign 0.00
R7616:4931414P19Rik UTSW 14 54585666 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCATCAGCGGTGCACACTTTC -3'
(R):5'- AAGGCCAGTTACTTGGAGCAC -3'

Sequencing Primer
(F):5'- TGCCGTAGCTCACCCAC -3'
(R):5'- GCACTTGTGAAGCGACCTATTAG -3'
Posted On2019-05-13