Incidental Mutation 'R7031:Dhh'
ID546345
Institutional Source Beutler Lab
Gene Symbol Dhh
Ensembl Gene ENSMUSG00000023000
Gene Namedesert hedgehog
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.632) question?
Stock #R7031 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location98891152-98898540 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 98894026 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 367 (G367E)
Ref Sequence ENSEMBL: ENSMUSP00000023737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023737] [ENSMUST00000229508] [ENSMUST00000229556] [ENSMUST00000229775]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023737
AA Change: G367E

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023737
Gene: ENSMUSG00000023000
AA Change: G367E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:HH_signal 23 185 2.1e-86 PFAM
Pfam:Peptidase_M15_3 129 185 5.9e-8 PFAM
HintN 197 304 1.29e-25 SMART
HintC 305 349 1.89e-9 SMART
low complexity region 358 374 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229508
Predicted Effect probably benign
Transcript: ENSMUST00000229556
Predicted Effect probably benign
Transcript: ENSMUST00000229775
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hedgehog family. The hedgehog gene family encodes signaling molecules that play an important role in regulating morphogenesis. This protein is predicted to be made as a precursor that is autocatalytically cleaved; the N-terminal portion is soluble and contains the signalling activity while the C-terminal portion is involved in precursor processing. More importantly, the C-terminal product covalently attaches a cholesterol moiety to the N-terminal product, restricting the N-terminal product to the cell surface and preventing it from freely diffusing throughout the organism. Defects in this protein have been associated with partial gonadal dysgenesis (PGD) accompanied by minifascicular polyneuropathy. This protein may be involved in both male gonadal differentiation and perineurial development. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mutants are male sterile, failing to produce mature spermatozoa; peripheral nerves are abnormal, with thin and disorganized perineurial sheaths. High penetrance of pseudohermaphroditism observed on some mixed backgrounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,968,103 I128V probably benign Het
4930432K21Rik C A 8: 84,166,684 P160Q possibly damaging Het
4931414P19Rik T C 14: 54,595,601 N39S probably benign Het
Abca13 C T 11: 9,621,892 R4818C probably damaging Het
Acadsb A G 7: 131,443,637 I433V probably benign Het
Acsl3 T A 1: 78,688,283 I142N probably benign Het
Api5 G A 2: 94,425,616 T242M probably benign Het
Ccdc88c T C 12: 100,945,064 E37G probably damaging Het
Cntnap4 C A 8: 112,858,242 Q1104K probably benign Het
Cry1 A G 10: 85,148,662 S183P probably benign Het
Cuzd1 A T 7: 131,308,851 F572I probably benign Het
Dcbld1 A T 10: 52,290,889 D104V probably damaging Het
Dhx15 T C 5: 52,184,589 D129G probably benign Het
Drd3 T A 16: 43,762,498 V86E probably damaging Het
Ebf1 A G 11: 44,621,968 T135A possibly damaging Het
Epha5 T C 5: 84,142,300 I428V probably benign Het
Epx T A 11: 87,875,523 probably benign Het
Fam83d T A 2: 158,785,307 N305K probably benign Het
Gchfr T A 2: 119,169,755 V39D probably benign Het
Ggnbp2 A G 11: 84,860,641 L111P probably damaging Het
Gnal G A 18: 67,222,588 G340D probably damaging Het
Gpat2 A G 2: 127,435,475 E745G probably damaging Het
Gpbp1l1 C T 4: 116,592,848 R438C probably damaging Het
Hmgxb4 C T 8: 75,029,572 Q171* probably null Het
Igkv4-91 G T 6: 68,768,558 R119S possibly damaging Het
Ing2 T C 8: 47,668,823 D230G probably benign Het
Itfg2 A G 6: 128,416,054 V82A probably damaging Het
Klhl22 T C 16: 17,777,026 S340P probably damaging Het
Lipm A T 19: 34,116,471 M263L probably benign Het
Ly96 A T 1: 16,688,563 E19V possibly damaging Het
Mark1 C T 1: 184,912,632 E376K possibly damaging Het
Mlip T A 9: 77,138,553 M375L probably benign Het
Mug1 A T 6: 121,838,714 N26Y probably benign Het
Olfr1032 C T 2: 86,008,595 A273V probably benign Het
Olfr1368 C T 13: 21,143,000 S19N probably benign Het
Olfr543 T A 7: 102,477,850 T7S probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rb1cc1 T C 1: 6,238,466 probably null Het
Rgs4 T C 1: 169,743,767 T178A probably benign Het
Sel1l2 T A 2: 140,340,123 K31N possibly damaging Het
Serpinf1 T C 11: 75,410,196 R398G probably damaging Het
Sgo2b C T 8: 63,940,044 E120K possibly damaging Het
Stard9 T C 2: 120,700,450 F2396S possibly damaging Het
Tcrg-V6 G A 13: 19,190,440 E25K probably benign Het
Trpc3 A C 3: 36,621,310 I893S probably benign Het
Trpc4ap C A 2: 155,692,215 R31L unknown Het
Vat1l A G 8: 114,271,432 R239G possibly damaging Het
Vmn1r56 T A 7: 5,196,262 R119* probably null Het
Vmn2r111 T C 17: 22,571,245 Y260C probably damaging Het
Zfp664 A G 5: 124,886,006 T155A probably benign Het
Other mutations in Dhh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Dhh APN 15 98898220 unclassified probably benign
IGL01845:Dhh APN 15 98897983 missense probably damaging 1.00
IGL02728:Dhh APN 15 98894311 splice site probably null
R0096:Dhh UTSW 15 98893988 missense probably benign 0.00
R1294:Dhh UTSW 15 98894383 missense probably benign 0.00
R1842:Dhh UTSW 15 98894560 splice site probably null
R4351:Dhh UTSW 15 98898218 unclassified probably benign
R4727:Dhh UTSW 15 98898142 missense probably damaging 0.99
R4744:Dhh UTSW 15 98894258 missense possibly damaging 0.86
R5120:Dhh UTSW 15 98898157 missense probably benign 0.05
R6419:Dhh UTSW 15 98894401 missense probably damaging 1.00
R6630:Dhh UTSW 15 98894366 missense possibly damaging 0.86
R7032:Dhh UTSW 15 98894026 missense possibly damaging 0.84
R7330:Dhh UTSW 15 98894410 missense probably damaging 1.00
X0060:Dhh UTSW 15 98894309 missense possibly damaging 0.95
Z1088:Dhh UTSW 15 98894909 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAAGTTCCTAGTACAGCCCAC -3'
(R):5'- TGACTTTGCACCGGTGTTC -3'

Sequencing Primer
(F):5'- GAAGTTCCTAGTACAGCCCACCTTTC -3'
(R):5'- TTACGTGCTGGCGACTCG -3'
Posted On2019-05-13