Incidental Mutation 'R7031:Vmn2r111'
ID 546348
Institutional Source Beutler Lab
Gene Symbol Vmn2r111
Ensembl Gene ENSMUSG00000095093
Gene Name vomeronasal 2, receptor 111
Synonyms EG210876
MMRRC Submission 045132-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R7031 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 22766922-22792254 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 22790226 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 260 (Y260C)
Ref Sequence ENSEMBL: ENSMUSP00000090148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092491]
AlphaFold K7N674
Predicted Effect probably damaging
Transcript: ENSMUST00000092491
AA Change: Y260C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: Y260C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.5e-29 PFAM
Pfam:NCD3G 512 565 1.1e-20 PFAM
Pfam:7tm_3 595 833 5.6e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik T C 14: 54,833,058 (GRCm39) N39S probably benign Het
Abca13 C T 11: 9,571,892 (GRCm39) R4818C probably damaging Het
Acadsb A G 7: 131,045,366 (GRCm39) I433V probably benign Het
Acsl3 T A 1: 78,666,000 (GRCm39) I142N probably benign Het
Api5 G A 2: 94,255,961 (GRCm39) T242M probably benign Het
Brme1 C A 8: 84,893,313 (GRCm39) P160Q possibly damaging Het
Ccdc88c T C 12: 100,911,323 (GRCm39) E37G probably damaging Het
Cfap96 T C 8: 46,421,140 (GRCm39) I128V probably benign Het
Cntnap4 C A 8: 113,584,874 (GRCm39) Q1104K probably benign Het
Cry1 A G 10: 84,984,526 (GRCm39) S183P probably benign Het
Cuzd1 A T 7: 130,910,580 (GRCm39) F572I probably benign Het
Dcbld1 A T 10: 52,166,985 (GRCm39) D104V probably damaging Het
Dhh C T 15: 98,791,907 (GRCm39) G367E possibly damaging Het
Dhx15 T C 5: 52,341,931 (GRCm39) D129G probably benign Het
Drd3 T A 16: 43,582,861 (GRCm39) V86E probably damaging Het
Ebf1 A G 11: 44,512,795 (GRCm39) T135A possibly damaging Het
Epha5 T C 5: 84,290,159 (GRCm39) I428V probably benign Het
Epx T A 11: 87,766,349 (GRCm39) probably benign Het
Fam83d T A 2: 158,627,227 (GRCm39) N305K probably benign Het
Gchfr T A 2: 119,000,236 (GRCm39) V39D probably benign Het
Ggnbp2 A G 11: 84,751,467 (GRCm39) L111P probably damaging Het
Gnal G A 18: 67,355,659 (GRCm39) G340D probably damaging Het
Gpat2 A G 2: 127,277,395 (GRCm39) E745G probably damaging Het
Gpbp1l1 C T 4: 116,450,045 (GRCm39) R438C probably damaging Het
Hmgxb4 C T 8: 75,756,200 (GRCm39) Q171* probably null Het
Igkv4-91 G T 6: 68,745,542 (GRCm39) R119S possibly damaging Het
Ing2 T C 8: 48,121,858 (GRCm39) D230G probably benign Het
Itfg2 A G 6: 128,393,017 (GRCm39) V82A probably damaging Het
Klhl22 T C 16: 17,594,890 (GRCm39) S340P probably damaging Het
Lipm A T 19: 34,093,871 (GRCm39) M263L probably benign Het
Ly96 A T 1: 16,758,787 (GRCm39) E19V possibly damaging Het
Mark1 C T 1: 184,644,829 (GRCm39) E376K possibly damaging Het
Mlip T A 9: 77,045,835 (GRCm39) M375L probably benign Het
Mug1 A T 6: 121,815,673 (GRCm39) N26Y probably benign Het
Or2ad1 C T 13: 21,327,170 (GRCm39) S19N probably benign Het
Or55b3 T A 7: 102,127,057 (GRCm39) T7S probably benign Het
Or5m3 C T 2: 85,838,939 (GRCm39) A273V probably benign Het
Ptk2 G A 15: 73,093,658 (GRCm39) P854S possibly damaging Het
Rb1cc1 T C 1: 6,308,690 (GRCm39) probably null Het
Rgs4 T C 1: 169,571,336 (GRCm39) T178A probably benign Het
Sel1l2 T A 2: 140,182,043 (GRCm39) K31N possibly damaging Het
Serpinf1 T C 11: 75,301,022 (GRCm39) R398G probably damaging Het
Sgo2b C T 8: 64,393,078 (GRCm39) E120K possibly damaging Het
Stard9 T C 2: 120,530,931 (GRCm39) F2396S possibly damaging Het
Trgv6 G A 13: 19,374,610 (GRCm39) E25K probably benign Het
Trpc3 A C 3: 36,675,459 (GRCm39) I893S probably benign Het
Trpc4ap C A 2: 155,534,135 (GRCm39) R31L unknown Het
Vat1l A G 8: 114,998,172 (GRCm39) R239G possibly damaging Het
Vmn1r56 T A 7: 5,199,261 (GRCm39) R119* probably null Het
Zfp664 A G 5: 124,963,070 (GRCm39) T155A probably benign Het
Other mutations in Vmn2r111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Vmn2r111 APN 17 22,767,734 (GRCm39) missense probably benign 0.00
IGL01306:Vmn2r111 APN 17 22,787,965 (GRCm39) missense probably damaging 0.99
IGL01309:Vmn2r111 APN 17 22,787,997 (GRCm39) missense possibly damaging 0.51
IGL01457:Vmn2r111 APN 17 22,790,966 (GRCm39) nonsense probably null
IGL01465:Vmn2r111 APN 17 22,767,718 (GRCm39) missense probably benign 0.00
IGL01505:Vmn2r111 APN 17 22,767,553 (GRCm39) missense probably benign 0.00
IGL01571:Vmn2r111 APN 17 22,790,373 (GRCm39) missense probably damaging 0.99
IGL01715:Vmn2r111 APN 17 22,788,054 (GRCm39) splice site probably benign
IGL01962:Vmn2r111 APN 17 22,767,265 (GRCm39) missense possibly damaging 0.90
IGL02190:Vmn2r111 APN 17 22,789,754 (GRCm39) missense probably benign 0.00
IGL02496:Vmn2r111 APN 17 22,787,837 (GRCm39) missense probably benign
IGL02519:Vmn2r111 APN 17 22,767,320 (GRCm39) missense possibly damaging 0.80
IGL02616:Vmn2r111 APN 17 22,790,031 (GRCm39) missense possibly damaging 0.67
IGL02641:Vmn2r111 APN 17 22,792,205 (GRCm39) missense possibly damaging 0.82
IGL02690:Vmn2r111 APN 17 22,778,023 (GRCm39) critical splice donor site probably null
IGL02698:Vmn2r111 APN 17 22,790,226 (GRCm39) missense probably damaging 1.00
IGL03017:Vmn2r111 APN 17 22,789,839 (GRCm39) missense probably damaging 1.00
R0046:Vmn2r111 UTSW 17 22,766,990 (GRCm39) missense probably benign
R0064:Vmn2r111 UTSW 17 22,791,053 (GRCm39) missense probably benign 0.00
R0519:Vmn2r111 UTSW 17 22,792,102 (GRCm39) missense probably benign 0.02
R1439:Vmn2r111 UTSW 17 22,790,097 (GRCm39) missense probably benign 0.00
R1467:Vmn2r111 UTSW 17 22,790,028 (GRCm39) missense probably damaging 0.99
R1467:Vmn2r111 UTSW 17 22,790,028 (GRCm39) missense probably damaging 0.99
R1636:Vmn2r111 UTSW 17 22,790,380 (GRCm39) missense probably damaging 1.00
R1647:Vmn2r111 UTSW 17 22,788,042 (GRCm39) missense probably benign 0.03
R1648:Vmn2r111 UTSW 17 22,788,042 (GRCm39) missense probably benign 0.03
R1697:Vmn2r111 UTSW 17 22,767,041 (GRCm39) missense probably benign 0.26
R1996:Vmn2r111 UTSW 17 22,767,062 (GRCm39) missense probably benign 0.21
R2040:Vmn2r111 UTSW 17 22,767,395 (GRCm39) missense probably damaging 1.00
R2075:Vmn2r111 UTSW 17 22,778,043 (GRCm39) missense probably damaging 1.00
R2134:Vmn2r111 UTSW 17 22,792,085 (GRCm39) missense possibly damaging 0.68
R2357:Vmn2r111 UTSW 17 22,778,151 (GRCm39) splice site probably benign
R3700:Vmn2r111 UTSW 17 22,790,142 (GRCm39) nonsense probably null
R3782:Vmn2r111 UTSW 17 22,790,301 (GRCm39) missense possibly damaging 0.89
R4085:Vmn2r111 UTSW 17 22,778,096 (GRCm39) missense probably benign 0.00
R4323:Vmn2r111 UTSW 17 22,792,159 (GRCm39) missense probably benign 0.02
R4900:Vmn2r111 UTSW 17 22,767,637 (GRCm39) missense possibly damaging 0.94
R5072:Vmn2r111 UTSW 17 22,767,022 (GRCm39) missense probably damaging 0.99
R5123:Vmn2r111 UTSW 17 22,790,124 (GRCm39) missense possibly damaging 0.82
R5181:Vmn2r111 UTSW 17 22,790,001 (GRCm39) missense possibly damaging 0.56
R5357:Vmn2r111 UTSW 17 22,767,083 (GRCm39) nonsense probably null
R5398:Vmn2r111 UTSW 17 22,792,252 (GRCm39) start codon destroyed probably null 0.88
R5434:Vmn2r111 UTSW 17 22,767,470 (GRCm39) missense probably damaging 0.99
R5462:Vmn2r111 UTSW 17 22,767,238 (GRCm39) missense probably damaging 1.00
R6149:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6149:Vmn2r111 UTSW 17 22,767,796 (GRCm39) missense probably benign 0.00
R6207:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6281:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6282:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6283:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6307:Vmn2r111 UTSW 17 22,792,070 (GRCm39) missense probably benign 0.00
R6323:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6325:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6367:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6368:Vmn2r111 UTSW 17 22,790,889 (GRCm39) missense probably benign 0.38
R6369:Vmn2r111 UTSW 17 22,767,583 (GRCm39) missense probably damaging 1.00
R6489:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6490:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6546:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6547:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6557:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6654:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6655:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6657:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6659:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6660:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6664:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6798:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6799:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6801:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6893:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6895:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6897:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6922:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6923:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6944:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6945:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7017:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7018:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7024:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7039:Vmn2r111 UTSW 17 22,767,165 (GRCm39) missense probably damaging 1.00
R7053:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7054:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7055:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7056:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7145:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7146:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7246:Vmn2r111 UTSW 17 22,767,695 (GRCm39) missense probably damaging 1.00
R7259:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7260:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7327:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7401:Vmn2r111 UTSW 17 22,790,067 (GRCm39) missense possibly damaging 0.93
R7514:Vmn2r111 UTSW 17 22,767,380 (GRCm39) missense probably benign 0.05
R7651:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7781:Vmn2r111 UTSW 17 22,789,714 (GRCm39) missense probably benign 0.17
R7816:Vmn2r111 UTSW 17 22,792,083 (GRCm39) missense probably damaging 0.97
R7821:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7838:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8078:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8080:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8117:Vmn2r111 UTSW 17 22,790,469 (GRCm39) missense probably benign 0.12
R8171:Vmn2r111 UTSW 17 22,792,073 (GRCm39) missense probably benign 0.10
R8195:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8197:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8411:Vmn2r111 UTSW 17 22,767,562 (GRCm39) missense probably benign 0.03
R8539:Vmn2r111 UTSW 17 22,790,274 (GRCm39) missense probably benign 0.23
R8540:Vmn2r111 UTSW 17 22,778,024 (GRCm39) missense probably damaging 1.00
R8540:Vmn2r111 UTSW 17 22,778,023 (GRCm39) critical splice donor site probably null
R8557:Vmn2r111 UTSW 17 22,790,910 (GRCm39) nonsense probably null
R8720:Vmn2r111 UTSW 17 22,792,194 (GRCm39) missense possibly damaging 0.88
R8729:Vmn2r111 UTSW 17 22,767,239 (GRCm39) missense probably damaging 1.00
R8843:Vmn2r111 UTSW 17 22,767,011 (GRCm39) missense probably benign 0.00
R9184:Vmn2r111 UTSW 17 22,790,822 (GRCm39) missense probably benign
R9374:Vmn2r111 UTSW 17 22,787,859 (GRCm39) missense probably benign 0.17
R9452:Vmn2r111 UTSW 17 22,778,132 (GRCm39) missense probably damaging 1.00
X0026:Vmn2r111 UTSW 17 22,767,676 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GACAGAGTTCAATGTCTGCAC -3'
(R):5'- TAGCACTTGCCCTGGTATCC -3'

Sequencing Primer
(F):5'- CCAGAAATCTCACTATTGTGTTGTTG -3'
(R):5'- CCTTCATAATTCATTTTGGTTGGAAC -3'
Posted On 2019-05-13