Incidental Mutation 'R7032:Strbp'
ID546354
Institutional Source Beutler Lab
Gene Symbol Strbp
Ensembl Gene ENSMUSG00000026915
Gene Namespermatid perinuclear RNA binding protein
Synonyms6430510M02Rik, Spnr, C230082I21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.499) question?
Stock #R7032 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location37483228-37703859 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37603113 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 387 (D387G)
Ref Sequence ENSEMBL: ENSMUSP00000139145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028279] [ENSMUST00000072186] [ENSMUST00000183690]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028279
AA Change: D387G

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028279
Gene: ENSMUSG00000026915
AA Change: D387G

DomainStartEndE-ValueType
DZF 81 334 2.45e-168 SMART
DSRM 388 452 3.11e-16 SMART
low complexity region 474 497 N/A INTRINSIC
DSRM 511 575 1.2e-22 SMART
low complexity region 578 593 N/A INTRINSIC
low complexity region 608 618 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000072186
AA Change: D387G

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072047
Gene: ENSMUSG00000026915
AA Change: D387G

DomainStartEndE-ValueType
DZF 81 334 2.45e-168 SMART
DSRM 388 452 3.11e-16 SMART
low complexity region 474 497 N/A INTRINSIC
DSRM 511 575 1.2e-22 SMART
low complexity region 578 593 N/A INTRINSIC
low complexity region 608 618 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000183690
AA Change: D387G

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139145
Gene: ENSMUSG00000026915
AA Change: D387G

DomainStartEndE-ValueType
DZF 81 334 2.45e-168 SMART
DSRM 388 452 3.11e-16 SMART
low complexity region 474 497 N/A INTRINSIC
DSRM 511 575 1.2e-22 SMART
low complexity region 578 593 N/A INTRINSIC
low complexity region 608 618 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (67/67)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap insertion exhibit premature death, a reduced body size and an abnormal clutching reflex. Minor brain abnormalities and spermatogenesis defects were also noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T G 8: 45,956,437 S282R probably damaging Het
2310003L06Rik T A 5: 87,972,579 D398E possibly damaging Het
Adam34 T C 8: 43,652,266 Y114C probably damaging Het
Akap9 T A 5: 3,954,896 D156E probably benign Het
Apba1 T A 19: 23,912,461 S408T probably benign Het
Asb14 C T 14: 26,903,455 H256Y probably benign Het
Atf6 A T 1: 170,799,612 probably null Het
Atp6v1b2 T A 8: 69,088,896 V35E probably benign Het
Atp8a2 T C 14: 60,017,840 probably null Het
Ccdc170 C A 10: 4,482,597 P12Q unknown Het
Cdh23 C T 10: 60,331,788 E1810K probably damaging Het
Cdo1 A T 18: 46,720,408 F94L probably damaging Het
Chdh C T 14: 30,036,852 P585S possibly damaging Het
Clasp2 A G 9: 113,854,323 N407S probably benign Het
Clca3a1 T A 3: 144,747,568 S465C probably benign Het
Clip2 C A 5: 134,522,630 V213L probably damaging Het
Col6a6 A G 9: 105,767,508 S1194P probably damaging Het
Cyp7a1 T C 4: 6,268,463 T421A possibly damaging Het
Dhh C T 15: 98,894,026 G367E possibly damaging Het
Dnah5 A G 15: 28,326,650 N2002D probably damaging Het
Epn2 T A 11: 61,546,702 N15Y probably damaging Het
Evi5 A C 5: 107,788,281 V647G probably benign Het
Eya1 T C 1: 14,283,200 probably null Het
Fam120a A G 13: 48,949,113 V222A probably benign Het
Fastkd5 A T 2: 130,615,944 I242K possibly damaging Het
Hnrnpul1 A G 7: 25,750,894 M131T probably benign Het
Ice1 T C 13: 70,596,164 N2100S probably damaging Het
Ifi205 T A 1: 174,028,350 D38V possibly damaging Het
Klhl9 G A 4: 88,721,606 Q133* probably null Het
Krt84 T C 15: 101,528,489 E370G probably benign Het
Lrrc4c T C 2: 97,629,065 I12T probably benign Het
Lrriq4 T A 3: 30,655,701 L398* probably null Het
Ltf G A 9: 111,026,130 probably null Het
Macf1 C T 4: 123,472,308 V1322I probably benign Het
Mark2 T A 19: 7,287,333 I112L probably damaging Het
Mterf2 A T 10: 85,120,663 C32* probably null Het
Myo3b C T 2: 70,095,264 T25I probably damaging Het
Nsun7 A C 5: 66,264,035 I115L probably benign Het
Olfm3 G A 3: 115,090,156 V36M probably damaging Het
Olfr1174-ps T C 2: 88,311,029 T256A probably benign Het
Olfr147 A T 9: 38,403,669 Y262F possibly damaging Het
Olfr1537 A T 9: 39,237,687 S246T possibly damaging Het
Olfr406 T C 11: 74,269,602 I71T possibly damaging Het
Pcdhgb8 A T 18: 37,763,909 R677S probably benign Het
Prrt4 A C 6: 29,170,539 L638R possibly damaging Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rab44 T C 17: 29,140,464 F542S unknown Het
Rhobtb3 T A 13: 75,872,394 E596D probably benign Het
Rpl36 T C 17: 56,613,944 I44T probably benign Het
Rptor A G 11: 119,846,936 I112V probably benign Het
Rrnad1 A G 3: 87,924,342 probably null Het
Rxfp2 T C 5: 150,070,348 I611T probably damaging Het
Slc12a4 G T 8: 105,949,233 N553K probably damaging Het
Spata31d1d T A 13: 59,728,232 R496S probably benign Het
Tas2r107 A T 6: 131,659,190 C299S possibly damaging Het
Tbc1d21 A T 9: 58,366,851 probably null Het
Tdrd12 A T 7: 35,481,046 Y847* probably null Het
Tlr2 A T 3: 83,837,905 N290K probably benign Het
Tmppe A G 9: 114,405,790 T386A probably damaging Het
Tnks1bp1 C A 2: 85,061,953 H741Q probably benign Het
Trpc6 G A 9: 8,609,950 V140M probably damaging Het
Ttn T C 2: 76,811,588 D13427G probably damaging Het
Uba7 C A 9: 107,976,172 L106I possibly damaging Het
Unc5b T G 10: 60,778,808 T237P probably damaging Het
Vit A C 17: 78,624,865 D467A probably damaging Het
Vmn1r103 T C 7: 20,509,855 Y227C possibly damaging Het
Vmn1r77 T A 7: 12,042,090 Y196* probably null Het
Zhx3 A G 2: 160,780,978 V423A probably damaging Het
Other mutations in Strbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Strbp APN 2 37586504 splice site probably benign
IGL00656:Strbp APN 2 37603138 splice site probably benign
IGL01376:Strbp APN 2 37645651 missense probably damaging 1.00
IGL01998:Strbp APN 2 37625285 missense probably damaging 1.00
IGL02347:Strbp APN 2 37645648 missense probably benign 0.25
IGL02453:Strbp APN 2 37586508 critical splice donor site probably null
IGL02804:Strbp APN 2 37624486 splice site probably benign
IGL03102:Strbp APN 2 37586503 splice site probably benign
PIT4418001:Strbp UTSW 2 37645492 missense probably benign
R0382:Strbp UTSW 2 37600826 missense probably benign 0.00
R0575:Strbp UTSW 2 37640873 missense possibly damaging 0.87
R0610:Strbp UTSW 2 37584077 missense probably damaging 0.97
R0825:Strbp UTSW 2 37635527 missense probably benign 0.00
R1829:Strbp UTSW 2 37640909 missense possibly damaging 0.63
R1831:Strbp UTSW 2 37625265 missense possibly damaging 0.71
R3416:Strbp UTSW 2 37590725 missense possibly damaging 0.94
R3417:Strbp UTSW 2 37590725 missense possibly damaging 0.94
R4673:Strbp UTSW 2 37645679 missense probably damaging 1.00
R5093:Strbp UTSW 2 37627487 missense probably damaging 0.99
R5099:Strbp UTSW 2 37603018 missense probably damaging 0.98
R5269:Strbp UTSW 2 37627443 missense possibly damaging 0.87
R5378:Strbp UTSW 2 37599174 missense probably damaging 1.00
R5378:Strbp UTSW 2 37600806 missense probably benign 0.03
R5454:Strbp UTSW 2 37645483 missense probably benign 0.00
R5905:Strbp UTSW 2 37625255 missense probably damaging 1.00
R6028:Strbp UTSW 2 37625255 missense probably damaging 1.00
R6374:Strbp UTSW 2 37603008 missense probably damaging 1.00
R6700:Strbp UTSW 2 37603963 missense probably null 0.01
R6800:Strbp UTSW 2 37625216 missense probably damaging 1.00
R7139:Strbp UTSW 2 37624502 missense probably benign 0.00
R7261:Strbp UTSW 2 37641137 intron probably null
R7481:Strbp UTSW 2 37600754 missense probably benign 0.02
R7718:Strbp UTSW 2 37625282 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCACATGAAGCTTTGCTGTTT -3'
(R):5'- AAGACATCAATGCTGACAAATAGAAA -3'

Sequencing Primer
(F):5'- CACATGAAGCTTTGCTGTTTTCTTG -3'
(R):5'- GGACTGAACTCAGATCTTCTGCAAG -3'
Posted On2019-05-13