Incidental Mutation 'R0610:Mapk9'
ID54638
Institutional Source Beutler Lab
Gene Symbol Mapk9
Ensembl Gene ENSMUSG00000020366
Gene Namemitogen-activated protein kinase 9
SynonymsJNK2, JNK/SAPK alpha, Prkm9
MMRRC Submission 038799-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.354) question?
Stock #R0610 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location49846751-49886421 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 49863573 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 51 (N51T)
Ref Sequence ENSEMBL: ENSMUSP00000136977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020634] [ENSMUST00000043321] [ENSMUST00000102778] [ENSMUST00000109178] [ENSMUST00000109179] [ENSMUST00000164643] [ENSMUST00000178543]
Predicted Effect probably benign
Transcript: ENSMUST00000020634
AA Change: N51T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000020634
Gene: ENSMUSG00000020366
AA Change: N51T

DomainStartEndE-ValueType
S_TKc 26 321 4.01e-87 SMART
low complexity region 387 399 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043321
AA Change: N51T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000042744
Gene: ENSMUSG00000020366
AA Change: N51T

DomainStartEndE-ValueType
S_TKc 26 321 7.6e-88 SMART
low complexity region 387 399 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102778
AA Change: N51T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000099839
Gene: ENSMUSG00000020366
AA Change: N51T

DomainStartEndE-ValueType
S_TKc 26 321 7.6e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109178
AA Change: N51T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000104807
Gene: ENSMUSG00000020366
AA Change: N51T

DomainStartEndE-ValueType
S_TKc 26 321 4.01e-87 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109179
AA Change: N51T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000104808
Gene: ENSMUSG00000020366
AA Change: N51T

DomainStartEndE-ValueType
S_TKc 26 321 7.6e-88 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151695
Predicted Effect probably benign
Transcript: ENSMUST00000164643
AA Change: N51T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000132864
Gene: ENSMUSG00000020366
AA Change: N51T

DomainStartEndE-ValueType
S_TKc 26 321 4.01e-87 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178543
AA Change: N51T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000136977
Gene: ENSMUSG00000020366
AA Change: N51T

DomainStartEndE-ValueType
S_TKc 26 321 7.6e-88 SMART
low complexity region 387 399 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
Meta Mutation Damage Score 0.0778 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase targets specific transcription factors, and thus mediates immediate-early gene expression in response to various cell stimuli. It is most closely related to MAPK8, both of which are involved in UV radiation induced apoptosis, thought to be related to the cytochrome c-mediated cell death pathway. This gene and MAPK8 are also known as c-Jun N-terminal kinases. This kinase blocks the ubiquitination of tumor suppressor p53, and thus it increases the stability of p53 in nonstressed cells. Studies of this gene's mouse counterpart suggest a key role in T-cell differentiation. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Sep 2008]
PHENOTYPE: Homozygotes for a null allele show resistance to TNF-induced liver injury, impaired TH1 cell differentiation, and enhanced epidermal differentiation and proliferation. Homozygotes for a reporter allele show impaired T-cell activation and apoptosis, resistance to I-R cardiac injury, and reduced LTP. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4930578I06Rik G A 14: 63,986,265 R21* probably null Het
9530003J23Rik A G 10: 117,237,730 F66S probably benign Het
Abca15 A G 7: 120,365,786 E757G possibly damaging Het
Abca5 T C 11: 110,301,527 T720A probably benign Het
Actr5 T A 2: 158,632,456 probably null Het
Adgrl3 T C 5: 81,693,716 probably benign Het
Adra1a A G 14: 66,637,792 D72G probably damaging Het
Ahnak G T 19: 9,007,878 L2175F probably benign Het
AK157302 A G 13: 21,495,663 T120A possibly damaging Het
Apol7a G A 15: 77,389,254 A336V probably benign Het
Asic1 C A 15: 99,698,899 H525Q probably benign Het
Atxn7l2 T C 3: 108,204,774 D335G possibly damaging Het
Bpgm G T 6: 34,504,349 R227L possibly damaging Het
Calm4 T A 13: 3,838,320 V142E possibly damaging Het
Catsperg1 A T 7: 29,190,619 L721Q probably damaging Het
Cdh26 A G 2: 178,449,898 I83M probably damaging Het
Cep295 A C 9: 15,322,754 S2249A possibly damaging Het
Cln3 A G 7: 126,580,189 F139L probably damaging Het
Cmpk2 T A 12: 26,478,056 L424Q possibly damaging Het
Col12a1 A T 9: 79,707,848 V53E probably benign Het
Csmd1 G A 8: 15,918,208 R3140C possibly damaging Het
Dagla A G 19: 10,271,558 W11R probably damaging Het
Dbx2 C T 15: 95,624,897 V310M probably benign Het
Disp2 T A 2: 118,792,236 C1150S probably benign Het
Dock3 T C 9: 107,023,788 D326G probably damaging Het
Dph1 G T 11: 75,185,957 probably benign Het
Dyrk1b C A 7: 28,186,634 T594K probably damaging Het
Evx2 C A 2: 74,655,987 A353S probably benign Het
Fam71f1 T A 6: 29,326,577 V231E probably benign Het
Gm4737 T C 16: 46,153,901 E371G probably damaging Het
Gm4788 G A 1: 139,701,846 T799I probably benign Het
Greb1 A C 12: 16,696,442 S1276A probably benign Het
Hhipl1 T A 12: 108,319,402 C490* probably null Het
Hmmr G T 11: 40,715,902 T231K probably damaging Het
Hspa4l A C 3: 40,779,400 E526D probably benign Het
Ibsp A G 5: 104,310,134 E179G probably benign Het
Ift140 C T 17: 25,035,803 A150V probably benign Het
Igf2bp2 A G 16: 22,070,309 S416P probably benign Het
Ighe T C 12: 113,271,743 K294E unknown Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kng2 T A 16: 23,000,594 N231Y possibly damaging Het
Lca5 A T 9: 83,399,739 C331S probably benign Het
Lrrc1 A G 9: 77,472,206 I101T possibly damaging Het
Lrrk2 A T 15: 91,815,416 I2489L probably benign Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Nek2 T A 1: 191,822,515 V113D probably damaging Het
Nr4a3 C A 4: 48,051,903 A248E probably benign Het
Nrp1 T C 8: 128,502,618 I859T probably damaging Het
Olfm5 A T 7: 104,154,445 Y195* probably null Het
Olfr354 T A 2: 36,907,659 W238R probably damaging Het
Olfr71 T A 4: 43,706,400 H56L possibly damaging Het
Olfr955 A G 9: 39,469,823 L301P probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pcnx2 A G 8: 125,839,687 W1006R probably damaging Het
Pdpk1 T C 17: 24,098,171 probably null Het
Ryr2 T A 13: 11,622,952 H3731L probably damaging Het
Sdr16c5 T G 4: 4,016,116 E103D possibly damaging Het
Setdb2 A C 14: 59,417,470 S324A possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc17a8 A T 10: 89,576,626 I499K probably damaging Het
Slc2a9 T A 5: 38,379,942 I389F probably damaging Het
Slc30a1 T C 1: 191,909,424 V394A probably damaging Het
Slc41a2 A G 10: 83,283,728 I390T possibly damaging Het
Slco1a1 A G 6: 141,918,461 probably null Het
Slit2 A G 5: 48,275,674 K1053E possibly damaging Het
Smarca2 T A 19: 26,691,391 L930Q probably damaging Het
Snx6 T C 12: 54,751,789 H387R probably damaging Het
Sox5 A T 6: 143,833,439 M622K possibly damaging Het
Ston1 C A 17: 88,635,281 N38K possibly damaging Het
Strbp C T 2: 37,584,077 V658I probably damaging Het
Strn3 T C 12: 51,610,448 probably null Het
Suco T G 1: 161,859,503 D96A probably benign Het
Suco A G 1: 161,864,032 probably benign Het
Sytl2 A T 7: 90,380,853 probably benign Het
Tmem41b T A 7: 109,981,083 M25L probably benign Het
Tmem41b T A 7: 109,981,085 D91V probably damaging Het
Tmem50b C T 16: 91,583,286 A68T probably damaging Het
Tmprss11e G A 5: 86,707,347 Q400* probably null Het
Tnfsf13b G A 8: 10,031,661 probably null Het
Trappc8 A G 18: 20,837,188 V916A probably damaging Het
Trdn G T 10: 33,474,453 V673F probably damaging Het
Trim28 G T 7: 13,025,784 probably benign Het
Txnrd2 T C 16: 18,472,882 V427A probably damaging Het
Uggt1 T C 1: 36,165,506 probably benign Het
Vmn1r36 A G 6: 66,716,420 L51P probably damaging Het
Vmn1r63 T A 7: 5,803,064 M190L possibly damaging Het
Vmn2r116 T A 17: 23,387,312 N399K probably damaging Het
Vmn2r117 T C 17: 23,475,514 N453S probably benign Het
Wbp1l T A 19: 46,654,670 I370N probably damaging Het
Zfp445 T C 9: 122,852,981 K632E probably benign Het
Zfp850 C T 7: 27,989,394 R463H probably damaging Het
Zyg11a A G 4: 108,204,857 L249P probably damaging Het
Other mutations in Mapk9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03085:Mapk9 APN 11 49867038 missense probably damaging 1.00
IGL03399:Mapk9 APN 11 49883299 utr 3 prime probably benign
Infirm UTSW 11 49863556 missense probably damaging 1.00
R0003:Mapk9 UTSW 11 49867039 missense possibly damaging 0.52
R0676:Mapk9 UTSW 11 49883156 makesense probably null
R0681:Mapk9 UTSW 11 49869245 missense probably damaging 1.00
R0736:Mapk9 UTSW 11 49883254 missense possibly damaging 0.58
R1186:Mapk9 UTSW 11 49878269 missense probably damaging 0.99
R1964:Mapk9 UTSW 11 49854333 missense probably null 1.00
R2424:Mapk9 UTSW 11 49863672 missense probably damaging 1.00
R4876:Mapk9 UTSW 11 49854325 missense probably damaging 0.97
R6191:Mapk9 UTSW 11 49863556 missense probably damaging 1.00
R7059:Mapk9 UTSW 11 49867047 splice site probably null
R7484:Mapk9 UTSW 11 49872836 missense probably damaging 0.97
RF010:Mapk9 UTSW 11 49854256 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TTGGCCTGGGAAAGCATAATCAGTC -3'
(R):5'- CAATCTTCGGTCTGGTCACACCAC -3'

Sequencing Primer
(F):5'- GGAAGAATTGCTGAATCCCTCTC -3'
(R):5'- GGTCTGGTCACACCACTAACATC -3'
Posted On2013-07-11