Incidental Mutation 'R0610:Greb1'
ID54641
Institutional Source Beutler Lab
Gene Symbol Greb1
Ensembl Gene ENSMUSG00000036523
Gene Namegene regulated by estrogen in breast cancer protein
Synonyms5730583K22Rik
MMRRC Submission 038799-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0610 (G1)
Quality Score157
Status Validated
Chromosome12
Chromosomal Location16670615-16800886 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 16696442 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 1276 (S1276A)
Ref Sequence ENSEMBL: ENSMUSP00000124348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048064] [ENSMUST00000159120] [ENSMUST00000162112]
Predicted Effect probably benign
Transcript: ENSMUST00000048064
AA Change: S1276A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523
AA Change: S1276A

DomainStartEndE-ValueType
Pfam:GREB1 1 1954 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159120
AA Change: S1248A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523
AA Change: S1248A

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1100 1118 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1596 1607 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161036
Predicted Effect probably benign
Transcript: ENSMUST00000162112
AA Change: S1276A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523
AA Change: S1276A

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1128 1146 N/A INTRINSIC
low complexity region 1224 1235 N/A INTRINSIC
low complexity region 1279 1293 N/A INTRINSIC
low complexity region 1624 1635 N/A INTRINSIC
Meta Mutation Damage Score 0.0758 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4930578I06Rik G A 14: 63,986,265 R21* probably null Het
9530003J23Rik A G 10: 117,237,730 F66S probably benign Het
Abca15 A G 7: 120,365,786 E757G possibly damaging Het
Abca5 T C 11: 110,301,527 T720A probably benign Het
Actr5 T A 2: 158,632,456 probably null Het
Adgrl3 T C 5: 81,693,716 probably benign Het
Adra1a A G 14: 66,637,792 D72G probably damaging Het
Ahnak G T 19: 9,007,878 L2175F probably benign Het
AK157302 A G 13: 21,495,663 T120A possibly damaging Het
Apol7a G A 15: 77,389,254 A336V probably benign Het
Asic1 C A 15: 99,698,899 H525Q probably benign Het
Atxn7l2 T C 3: 108,204,774 D335G possibly damaging Het
Bpgm G T 6: 34,504,349 R227L possibly damaging Het
Calm4 T A 13: 3,838,320 V142E possibly damaging Het
Catsperg1 A T 7: 29,190,619 L721Q probably damaging Het
Cdh26 A G 2: 178,449,898 I83M probably damaging Het
Cep295 A C 9: 15,322,754 S2249A possibly damaging Het
Cln3 A G 7: 126,580,189 F139L probably damaging Het
Cmpk2 T A 12: 26,478,056 L424Q possibly damaging Het
Col12a1 A T 9: 79,707,848 V53E probably benign Het
Csmd1 G A 8: 15,918,208 R3140C possibly damaging Het
Dagla A G 19: 10,271,558 W11R probably damaging Het
Dbx2 C T 15: 95,624,897 V310M probably benign Het
Disp2 T A 2: 118,792,236 C1150S probably benign Het
Dock3 T C 9: 107,023,788 D326G probably damaging Het
Dph1 G T 11: 75,185,957 probably benign Het
Dyrk1b C A 7: 28,186,634 T594K probably damaging Het
Evx2 C A 2: 74,655,987 A353S probably benign Het
Fam71f1 T A 6: 29,326,577 V231E probably benign Het
Gm4737 T C 16: 46,153,901 E371G probably damaging Het
Gm4788 G A 1: 139,701,846 T799I probably benign Het
Hhipl1 T A 12: 108,319,402 C490* probably null Het
Hmmr G T 11: 40,715,902 T231K probably damaging Het
Hspa4l A C 3: 40,779,400 E526D probably benign Het
Ibsp A G 5: 104,310,134 E179G probably benign Het
Ift140 C T 17: 25,035,803 A150V probably benign Het
Igf2bp2 A G 16: 22,070,309 S416P probably benign Het
Ighe T C 12: 113,271,743 K294E unknown Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kng2 T A 16: 23,000,594 N231Y possibly damaging Het
Lca5 A T 9: 83,399,739 C331S probably benign Het
Lrrc1 A G 9: 77,472,206 I101T possibly damaging Het
Lrrk2 A T 15: 91,815,416 I2489L probably benign Het
Mapk9 A C 11: 49,863,573 N51T probably benign Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Nek2 T A 1: 191,822,515 V113D probably damaging Het
Nr4a3 C A 4: 48,051,903 A248E probably benign Het
Nrp1 T C 8: 128,502,618 I859T probably damaging Het
Olfm5 A T 7: 104,154,445 Y195* probably null Het
Olfr354 T A 2: 36,907,659 W238R probably damaging Het
Olfr71 T A 4: 43,706,400 H56L possibly damaging Het
Olfr955 A G 9: 39,469,823 L301P probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pcnx2 A G 8: 125,839,687 W1006R probably damaging Het
Pdpk1 T C 17: 24,098,171 probably null Het
Ryr2 T A 13: 11,622,952 H3731L probably damaging Het
Sdr16c5 T G 4: 4,016,116 E103D possibly damaging Het
Setdb2 A C 14: 59,417,470 S324A possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc17a8 A T 10: 89,576,626 I499K probably damaging Het
Slc2a9 T A 5: 38,379,942 I389F probably damaging Het
Slc30a1 T C 1: 191,909,424 V394A probably damaging Het
Slc41a2 A G 10: 83,283,728 I390T possibly damaging Het
Slco1a1 A G 6: 141,918,461 probably null Het
Slit2 A G 5: 48,275,674 K1053E possibly damaging Het
Smarca2 T A 19: 26,691,391 L930Q probably damaging Het
Snx6 T C 12: 54,751,789 H387R probably damaging Het
Sox5 A T 6: 143,833,439 M622K possibly damaging Het
Ston1 C A 17: 88,635,281 N38K possibly damaging Het
Strbp C T 2: 37,584,077 V658I probably damaging Het
Strn3 T C 12: 51,610,448 probably null Het
Suco T G 1: 161,859,503 D96A probably benign Het
Suco A G 1: 161,864,032 probably benign Het
Sytl2 A T 7: 90,380,853 probably benign Het
Tmem41b T A 7: 109,981,083 M25L probably benign Het
Tmem41b T A 7: 109,981,085 D91V probably damaging Het
Tmem50b C T 16: 91,583,286 A68T probably damaging Het
Tmprss11e G A 5: 86,707,347 Q400* probably null Het
Tnfsf13b G A 8: 10,031,661 probably null Het
Trappc8 A G 18: 20,837,188 V916A probably damaging Het
Trdn G T 10: 33,474,453 V673F probably damaging Het
Trim28 G T 7: 13,025,784 probably benign Het
Txnrd2 T C 16: 18,472,882 V427A probably damaging Het
Uggt1 T C 1: 36,165,506 probably benign Het
Vmn1r36 A G 6: 66,716,420 L51P probably damaging Het
Vmn1r63 T A 7: 5,803,064 M190L possibly damaging Het
Vmn2r116 T A 17: 23,387,312 N399K probably damaging Het
Vmn2r117 T C 17: 23,475,514 N453S probably benign Het
Wbp1l T A 19: 46,654,670 I370N probably damaging Het
Zfp445 T C 9: 122,852,981 K632E probably benign Het
Zfp850 C T 7: 27,989,394 R463H probably damaging Het
Zyg11a A G 4: 108,204,857 L249P probably damaging Het
Other mutations in Greb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Greb1 APN 12 16711961 missense probably damaging 1.00
IGL01316:Greb1 APN 12 16698586 missense probably benign 0.04
IGL01464:Greb1 APN 12 16714826 missense probably damaging 0.99
IGL01474:Greb1 APN 12 16684501 missense probably benign
IGL01522:Greb1 APN 12 16701201 missense probably damaging 1.00
IGL01824:Greb1 APN 12 16711716 nonsense probably null
IGL01837:Greb1 APN 12 16684451 missense probably benign 0.19
IGL01991:Greb1 APN 12 16699681 missense probably damaging 1.00
IGL01996:Greb1 APN 12 16690845 missense possibly damaging 0.70
IGL02213:Greb1 APN 12 16706232 missense probably damaging 1.00
IGL02267:Greb1 APN 12 16717208 missense probably benign 0.00
IGL02512:Greb1 APN 12 16692712 missense possibly damaging 0.79
IGL02583:Greb1 APN 12 16706295 splice site probably benign
IGL02613:Greb1 APN 12 16739888 critical splice donor site probably null
IGL02648:Greb1 APN 12 16708682 missense probably damaging 1.00
IGL02679:Greb1 APN 12 16708723 missense probably damaging 1.00
Eared UTSW 12 16673863 missense probably damaging 1.00
Humpback UTSW 12 16701171 missense probably damaging 1.00
pied_billed UTSW 12 16724857 missense possibly damaging 0.79
IGL03048:Greb1 UTSW 12 16733331 missense probably damaging 1.00
R0083:Greb1 UTSW 12 16696451 missense probably benign
R0100:Greb1 UTSW 12 16680224 missense probably benign 0.41
R0100:Greb1 UTSW 12 16680224 missense probably benign 0.41
R0220:Greb1 UTSW 12 16682286 missense probably damaging 1.00
R0245:Greb1 UTSW 12 16696456 missense probably damaging 1.00
R0540:Greb1 UTSW 12 16682193 missense probably damaging 1.00
R0547:Greb1 UTSW 12 16723411 missense probably benign
R0563:Greb1 UTSW 12 16680267 missense probably benign 0.23
R0607:Greb1 UTSW 12 16682193 missense probably damaging 1.00
R0652:Greb1 UTSW 12 16696456 missense probably damaging 1.00
R0659:Greb1 UTSW 12 16680212 missense probably damaging 0.99
R0945:Greb1 UTSW 12 16673802 missense probably benign 0.31
R1055:Greb1 UTSW 12 16682251 missense probably damaging 0.98
R1445:Greb1 UTSW 12 16707851 missense probably damaging 1.00
R1471:Greb1 UTSW 12 16711774 missense probably damaging 0.97
R1503:Greb1 UTSW 12 16724819 nonsense probably null
R1566:Greb1 UTSW 12 16711828 missense possibly damaging 0.94
R1614:Greb1 UTSW 12 16701171 missense probably damaging 1.00
R1623:Greb1 UTSW 12 16674770 missense probably damaging 1.00
R1751:Greb1 UTSW 12 16723438 splice site probably benign
R1778:Greb1 UTSW 12 16690894 missense probably benign
R1842:Greb1 UTSW 12 16696243 missense probably damaging 1.00
R2040:Greb1 UTSW 12 16702650 missense probably damaging 1.00
R2153:Greb1 UTSW 12 16699532 missense probably damaging 1.00
R2178:Greb1 UTSW 12 16696387 missense probably damaging 1.00
R2194:Greb1 UTSW 12 16690908 missense probably benign 0.08
R2248:Greb1 UTSW 12 16680378 missense possibly damaging 0.90
R2474:Greb1 UTSW 12 16714953 missense possibly damaging 0.93
R2509:Greb1 UTSW 12 16724922 missense probably damaging 1.00
R2860:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2861:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2862:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2866:Greb1 UTSW 12 16699550 missense probably damaging 1.00
R2890:Greb1 UTSW 12 16704478 missense probably damaging 1.00
R3056:Greb1 UTSW 12 16688591 missense probably damaging 0.96
R3863:Greb1 UTSW 12 16702420 missense probably damaging 1.00
R3864:Greb1 UTSW 12 16702420 missense probably damaging 1.00
R3956:Greb1 UTSW 12 16682299 missense probably damaging 1.00
R4493:Greb1 UTSW 12 16698610 missense probably benign 0.14
R4548:Greb1 UTSW 12 16699675 missense probably damaging 1.00
R4683:Greb1 UTSW 12 16711773 missense possibly damaging 0.75
R4739:Greb1 UTSW 12 16696328 missense probably damaging 1.00
R4770:Greb1 UTSW 12 16681356 missense probably benign 0.03
R4838:Greb1 UTSW 12 16684360 critical splice donor site probably null
R4925:Greb1 UTSW 12 16681471 missense probably damaging 1.00
R4982:Greb1 UTSW 12 16724761 missense probably damaging 0.98
R5009:Greb1 UTSW 12 16724857 missense possibly damaging 0.79
R5086:Greb1 UTSW 12 16708022 intron probably benign
R5213:Greb1 UTSW 12 16714790 nonsense probably null
R5310:Greb1 UTSW 12 16716759 missense probably benign 0.09
R5353:Greb1 UTSW 12 16688566 nonsense probably null
R5544:Greb1 UTSW 12 16673796 missense probably damaging 1.00
R5605:Greb1 UTSW 12 16708726 missense probably damaging 0.96
R5708:Greb1 UTSW 12 16673842 missense probably benign 0.11
R5837:Greb1 UTSW 12 16688585 missense probably damaging 1.00
R5890:Greb1 UTSW 12 16733421 missense possibly damaging 0.90
R5938:Greb1 UTSW 12 16717258 missense probably damaging 1.00
R6049:Greb1 UTSW 12 16681394 missense probably damaging 0.99
R6093:Greb1 UTSW 12 16684486 missense probably benign
R6120:Greb1 UTSW 12 16708621 missense probably damaging 0.99
R6175:Greb1 UTSW 12 16674770 missense probably damaging 1.00
R6247:Greb1 UTSW 12 16716675 missense probably damaging 1.00
R6274:Greb1 UTSW 12 16735151 missense probably damaging 0.97
R6376:Greb1 UTSW 12 16699579 missense probably damaging 0.97
R6523:Greb1 UTSW 12 16684373 missense possibly damaging 0.51
R6557:Greb1 UTSW 12 16710383 missense probably benign 0.00
R6602:Greb1 UTSW 12 16709440 missense probably benign 0.44
R6621:Greb1 UTSW 12 16692717 missense probably damaging 1.00
R6645:Greb1 UTSW 12 16698579 missense probably benign 0.07
R6725:Greb1 UTSW 12 16688567 missense probably damaging 1.00
R6750:Greb1 UTSW 12 16688583 missense probably benign 0.05
R6863:Greb1 UTSW 12 16684420 missense probably damaging 1.00
R6914:Greb1 UTSW 12 16707902 missense probably damaging 0.97
R6996:Greb1 UTSW 12 16723354 missense probably benign 0.00
R7083:Greb1 UTSW 12 16723314 missense probably benign
R7147:Greb1 UTSW 12 16733427 missense probably damaging 1.00
R7238:Greb1 UTSW 12 16674672 missense probably damaging 0.99
R7290:Greb1 UTSW 12 16711738 missense probably damaging 1.00
R7358:Greb1 UTSW 12 16724881 missense probably damaging 1.00
R7395:Greb1 UTSW 12 16709430 critical splice donor site probably null
R7526:Greb1 UTSW 12 16716765 missense probably benign 0.00
R7530:Greb1 UTSW 12 16717206 missense probably benign 0.02
R7536:Greb1 UTSW 12 16682185 missense probably damaging 1.00
R7643:Greb1 UTSW 12 16711996 missense probably damaging 0.99
R7732:Greb1 UTSW 12 16673863 missense probably damaging 1.00
R7740:Greb1 UTSW 12 16740121 start gained probably benign
R7747:Greb1 UTSW 12 16674795 missense probably benign 0.01
R7760:Greb1 UTSW 12 16723416 missense probably benign
R8043:Greb1 UTSW 12 16711789 missense probably damaging 1.00
R8259:Greb1 UTSW 12 16724924 nonsense probably null
Z1176:Greb1 UTSW 12 16696756 missense probably benign 0.00
Z1177:Greb1 UTSW 12 16702491 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGCAGTAAAACTGAAGACGACC -3'
(R):5'- ACAGCCTGATTCTAGCCTCAGGAC -3'

Sequencing Primer
(F):5'- GGCATGATACCCACCTGAG -3'
(R):5'- TGGTCGGAGGAGCTTGC -3'
Posted On2013-07-11