Incidental Mutation 'R7032:Rab44'
ID546412
Institutional Source Beutler Lab
Gene Symbol Rab44
Ensembl Gene ENSMUSG00000064147
Gene NameRAB44, member RAS oncogene family
Synonyms9830134C10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R7032 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location29135056-29148980 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29140464 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 542 (F542S)
Ref Sequence ENSEMBL: ENSMUSP00000085253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087942]
Predicted Effect unknown
Transcript: ENSMUST00000087942
AA Change: F542S
SMART Domains Protein: ENSMUSP00000085253
Gene: ENSMUSG00000064147
AA Change: F542S

DomainStartEndE-ValueType
coiled coil region 1 68 N/A INTRINSIC
low complexity region 143 157 N/A INTRINSIC
low complexity region 261 276 N/A INTRINSIC
RAB 538 701 1.11e-53 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T G 8: 45,956,437 S282R probably damaging Het
2310003L06Rik T A 5: 87,972,579 D398E possibly damaging Het
Adam34 T C 8: 43,652,266 Y114C probably damaging Het
Akap9 T A 5: 3,954,896 D156E probably benign Het
Apba1 T A 19: 23,912,461 S408T probably benign Het
Asb14 C T 14: 26,903,455 H256Y probably benign Het
Atf6 A T 1: 170,799,612 probably null Het
Atp6v1b2 T A 8: 69,088,896 V35E probably benign Het
Atp8a2 T C 14: 60,017,840 probably null Het
Ccdc170 C A 10: 4,482,597 P12Q unknown Het
Cdh23 C T 10: 60,331,788 E1810K probably damaging Het
Cdo1 A T 18: 46,720,408 F94L probably damaging Het
Chdh C T 14: 30,036,852 P585S possibly damaging Het
Clasp2 A G 9: 113,854,323 N407S probably benign Het
Clca3a1 T A 3: 144,747,568 S465C probably benign Het
Clip2 C A 5: 134,522,630 V213L probably damaging Het
Col6a6 A G 9: 105,767,508 S1194P probably damaging Het
Cyp7a1 T C 4: 6,268,463 T421A possibly damaging Het
Dhh C T 15: 98,894,026 G367E possibly damaging Het
Dnah5 A G 15: 28,326,650 N2002D probably damaging Het
Epn2 T A 11: 61,546,702 N15Y probably damaging Het
Evi5 A C 5: 107,788,281 V647G probably benign Het
Eya1 T C 1: 14,283,200 probably null Het
Fam120a A G 13: 48,949,113 V222A probably benign Het
Fastkd5 A T 2: 130,615,944 I242K possibly damaging Het
Hnrnpul1 A G 7: 25,750,894 M131T probably benign Het
Ice1 T C 13: 70,596,164 N2100S probably damaging Het
Ifi205 T A 1: 174,028,350 D38V possibly damaging Het
Klhl9 G A 4: 88,721,606 Q133* probably null Het
Krt84 T C 15: 101,528,489 E370G probably benign Het
Lrrc4c T C 2: 97,629,065 I12T probably benign Het
Lrriq4 T A 3: 30,655,701 L398* probably null Het
Ltf G A 9: 111,026,130 probably null Het
Macf1 C T 4: 123,472,308 V1322I probably benign Het
Mark2 T A 19: 7,287,333 I112L probably damaging Het
Mterf2 A T 10: 85,120,663 C32* probably null Het
Myo3b C T 2: 70,095,264 T25I probably damaging Het
Nsun7 A C 5: 66,264,035 I115L probably benign Het
Olfm3 G A 3: 115,090,156 V36M probably damaging Het
Olfr1174-ps T C 2: 88,311,029 T256A probably benign Het
Olfr147 A T 9: 38,403,669 Y262F possibly damaging Het
Olfr1537 A T 9: 39,237,687 S246T possibly damaging Het
Olfr406 T C 11: 74,269,602 I71T possibly damaging Het
Pcdhgb8 A T 18: 37,763,909 R677S probably benign Het
Prrt4 A C 6: 29,170,539 L638R possibly damaging Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rhobtb3 T A 13: 75,872,394 E596D probably benign Het
Rpl36 T C 17: 56,613,944 I44T probably benign Het
Rptor A G 11: 119,846,936 I112V probably benign Het
Rrnad1 A G 3: 87,924,342 probably null Het
Rxfp2 T C 5: 150,070,348 I611T probably damaging Het
Slc12a4 G T 8: 105,949,233 N553K probably damaging Het
Spata31d1d T A 13: 59,728,232 R496S probably benign Het
Strbp T C 2: 37,603,113 D387G possibly damaging Het
Tas2r107 A T 6: 131,659,190 C299S possibly damaging Het
Tbc1d21 A T 9: 58,366,851 probably null Het
Tdrd12 A T 7: 35,481,046 Y847* probably null Het
Tlr2 A T 3: 83,837,905 N290K probably benign Het
Tmppe A G 9: 114,405,790 T386A probably damaging Het
Tnks1bp1 C A 2: 85,061,953 H741Q probably benign Het
Trpc6 G A 9: 8,609,950 V140M probably damaging Het
Ttn T C 2: 76,811,588 D13427G probably damaging Het
Uba7 C A 9: 107,976,172 L106I possibly damaging Het
Unc5b T G 10: 60,778,808 T237P probably damaging Het
Vit A C 17: 78,624,865 D467A probably damaging Het
Vmn1r103 T C 7: 20,509,855 Y227C possibly damaging Het
Vmn1r77 T A 7: 12,042,090 Y196* probably null Het
Zhx3 A G 2: 160,780,978 V423A probably damaging Het
Other mutations in Rab44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Rab44 APN 17 29139737 missense probably benign
IGL01545:Rab44 APN 17 29147377 missense unknown
IGL02314:Rab44 APN 17 29139353 missense probably benign 0.04
IGL02402:Rab44 APN 17 29140516 missense probably benign 0.01
IGL02492:Rab44 APN 17 29146049 splice site probably benign
R0018:Rab44 UTSW 17 29139380 missense probably benign 0.03
R0135:Rab44 UTSW 17 29138132 missense probably benign 0.01
R0193:Rab44 UTSW 17 29140307 missense probably benign
R0398:Rab44 UTSW 17 29145370 splice site probably benign
R0403:Rab44 UTSW 17 29145261 missense probably damaging 1.00
R0608:Rab44 UTSW 17 29147343 splice site probably null
R0631:Rab44 UTSW 17 29139144 missense possibly damaging 0.91
R0762:Rab44 UTSW 17 29145270 missense unknown
R1128:Rab44 UTSW 17 29140461 missense possibly damaging 0.90
R1681:Rab44 UTSW 17 29140124 missense possibly damaging 0.47
R1706:Rab44 UTSW 17 29138106 missense probably damaging 1.00
R2679:Rab44 UTSW 17 29144477 splice site probably null
R3500:Rab44 UTSW 17 29138067 missense probably benign 0.09
R3709:Rab44 UTSW 17 29139869 missense probably benign 0.08
R4497:Rab44 UTSW 17 29139897 missense probably benign 0.04
R4655:Rab44 UTSW 17 29139194 missense probably benign
R4833:Rab44 UTSW 17 29136337 missense probably damaging 1.00
R4850:Rab44 UTSW 17 29140089 missense possibly damaging 0.95
R4926:Rab44 UTSW 17 29139555 missense probably benign 0.01
R5694:Rab44 UTSW 17 29140500 missense probably damaging 1.00
R5694:Rab44 UTSW 17 29145966 missense unknown
R5835:Rab44 UTSW 17 29148238 missense probably benign 0.13
R6146:Rab44 UTSW 17 29135417 start gained probably benign
R6629:Rab44 UTSW 17 29135780 start gained probably benign
R6814:Rab44 UTSW 17 29139810 missense probably benign 0.18
R6865:Rab44 UTSW 17 29139227 missense probably benign
R6872:Rab44 UTSW 17 29139810 missense probably benign 0.18
R7058:Rab44 UTSW 17 29138176 splice site probably null
R7207:Rab44 UTSW 17 29138039 nonsense probably null
R7218:Rab44 UTSW 17 29139444 missense
R7418:Rab44 UTSW 17 29140496 missense unknown
R7651:Rab44 UTSW 17 29148205 missense unknown
Predicted Primers PCR Primer
(F):5'- GTTCAGGTGGAGAGCAAGTC -3'
(R):5'- ACCTAAATTGCACGGTGCTTTG -3'

Sequencing Primer
(F):5'- AGAGCAAGTCAGGTGCCC -3'
(R):5'- CCTGTGGTGCATTATAAGCTAACCAG -3'
Posted On2019-05-13