Mutagenetix > Incidental Mutations

Incidental Mutation 'R7033:Otog'

546452

Institutional Source

Beutler Lab

Gene Symbol

Otog

Ensembl Gene

ENSMUSG00000009487

Gene Name

otogelin

Synonyms

Otgn

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.837) question?

Stock #

R7033 (G1)

Quality Score

221.009

Status

Validated

Chromosome

Chromosomal Location

46240987-46311434 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 46267398 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000130949 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164538]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000164538

SMART Domains

Protein: ENSMUSP00000130949
Gene: ENSMUSG00000009487

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	72	85	N/A	INTRINSIC
VWD	128	288	7.98e-45	SMART
C8	330	404	1.05e-13	SMART
VWC	463	505	1.24e0	SMART
VWD	490	655	4.94e-50	SMART
C8	693	758	1.23e-5	SMART
Pfam:TIL	767	831	3.4e-13	PFAM
VWC	935	983	1.83e0	SMART
VWD	962	1118	6.05e-45	SMART
C8	1153	1227	1.02e-34	SMART
Pfam:AbfB	1270	1384	7.5e-10	PFAM
low complexity region	1488	1513	N/A	INTRINSIC
low complexity region	1524	1536	N/A	INTRINSIC
low complexity region	1560	1578	N/A	INTRINSIC
low complexity region	1637	1644	N/A	INTRINSIC
low complexity region	1677	1696	N/A	INTRINSIC
low complexity region	1731	1748	N/A	INTRINSIC
VWD	2087	2251	2.37e-29	SMART
C8	2287	2356	4.93e-19	SMART
low complexity region	2443	2449	N/A	INTRINSIC
CT	2828	2911	3.46e-28	SMART

Meta Mutation Damage Score

0.9487

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

96% (70/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the acellular membranes of the inner ear. Disruption of the orthologous mouse gene shows that it plays a role in auditory and vestibular functions. It is involved in fibrillar network organization, the anchoring of otoconial membranes and cupulae to the neuroepithelia, and likely in sound stimulation resistance. Mutations in this gene cause autosomal recessive nonsyndromic deafness, type 18B. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for a number of different spontaneous and targeted mutations exhibit vestibular dysfunction, including circling, head tilt, impaired balance, coordination, and placing response. Mutants have impaired hearing, decreased brain stem auditory evoked potential, and ear abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700024B05Rik	A	G	14: 41,997,417	Y105C	probably damaging	Het
2610301B20Rik	A	G	4: 10,898,014	T199A	probably benign	Het
Acr	T	C	15: 89,569,500	S81P	probably benign	Het
Akr1c14	T	C	13: 4,079,178		probably null	Het
Ank2	C	A	3: 126,944,850	E2375*	probably null	Het
Avpi1	A	G	19: 42,124,977	W14R	probably damaging	Het
Brd4	A	G	17: 32,199,015	V55A	probably benign	Het
Casp8ap2	A	G	4: 32,639,392	N149D	probably damaging	Het
Ccl25	A	T	8: 4,349,641		probably benign	Het
Celf5	A	G	10: 81,462,714	L299P	probably damaging	Het
Cfap57	T	G	4: 118,613,126	T186P	possibly damaging	Het
Chrm4	A	G	2: 91,928,347	M367V	probably benign	Het
Col1a2	A	T	6: 4,516,904		probably benign	Het
Crybg3	G	A	16: 59,554,165	P2242L	probably damaging	Het
Cspg4	T	C	9: 56,888,074	V1031A	probably damaging	Het
Dbnl	C	A	11: 5,798,102	P313T	probably benign	Het
Dnah1	A	G	14: 31,264,925	F3637L	probably damaging	Het
Dnah7a	A	T	1: 53,479,661	I2979N	probably damaging	Het
Dusp10	T	C	1: 184,037,605	V256A	possibly damaging	Het
Erlin2	T	C	8: 27,031,764	V164A	probably benign	Het
Fam110a	T	C	2: 151,970,211	D213G	probably damaging	Het
Fkbp1a	T	C	2: 151,557,500		probably null	Het
Foxg1	G	A	12: 49,384,720		probably benign	Het
Gm12185	T	C	11: 48,915,999	S122G	probably benign	Het
Gm2042	A	T	12: 87,960,281	D456V	probably damaging	Het
Gm8857	G	T	5: 10,950,551		probably null	Het
Grin2b	A	G	6: 135,923,038	Y282H	probably damaging	Het
Gys2	T	C	6: 142,472,722	D27G	probably benign	Het
H2-DMa	T	A	17: 34,136,997		probably null	Het
Hectd4	T	A	5: 121,364,568	I4245N	possibly damaging	Het
Incenp	A	G	19: 9,893,372	Y298H	unknown	Het
Ints2	C	T	11: 86,233,085	G626R	probably damaging	Het
Kifc1	A	T	17: 33,883,697	V314E	probably damaging	Het
Lurap1l	C	T	4: 80,911,367	P5S	probably benign	Het
Mtmr11	A	G	3: 96,169,946	Y540C	probably damaging	Het
Muc4	C	A	16: 32,756,324		probably benign	Het
Myh13	A	G	11: 67,369,316	E1860G	possibly damaging	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Nbeal1	G	A	1: 60,310,947	G2385D	probably damaging	Het
Ncaph2	G	A	15: 89,371,356	A578T	probably benign	Het
Ncr1	T	C	7: 4,338,145	V8A	possibly damaging	Het
Nutm1	T	C	2: 112,256,168	T73A	probably damaging	Het
Olfm1	G	A	2: 28,229,336	D313N	probably damaging	Het
Olfr1196	T	A	2: 88,700,820	N170Y	probably damaging	Het
Olfr275	A	G	4: 52,826,089	M231V	probably benign	Het
Olfr749	A	G	14: 50,736,707	F152L	possibly damaging	Het
Peak1	G	T	9: 56,259,707	D312E	probably damaging	Het
Plekhg1	T	C	10: 3,940,251	I331T	probably damaging	Het
Polr1b	T	C	2: 129,115,642	V539A	possibly damaging	Het
Polr2a	A	T	11: 69,747,213	H143Q	possibly damaging	Het
Ppargc1b	G	T	18: 61,307,714	A711D	probably damaging	Het
Prnd	T	A	2: 131,953,442	C161S	possibly damaging	Het
Prrt4	A	G	6: 29,171,148	L435P	possibly damaging	Het
Psen2	C	T	1: 180,227,520		probably null	Het
Psg23	T	C	7: 18,614,744	E46G	possibly damaging	Het
Rasgef1b	C	T	5: 99,232,336	R350H	probably damaging	Het
Rfxank	G	C	8: 70,138,170	P16A	probably benign	Het
Sema6a	A	G	18: 47,248,570	I944T	probably damaging	Het
Serpinc1	A	G	1: 160,997,521	T313A	probably benign	Het
Slc27a4	T	C	2: 29,804,271	S36P	possibly damaging	Het
Slc36a1	C	A	11: 55,223,737	R214S	probably benign	Het
Sorl1	C	T	9: 42,030,983	S982N	possibly damaging	Het
Syt1	A	C	10: 108,690,936	D37E	probably benign	Het
Tcl1b5	A	T	12: 105,176,491	D26V	probably damaging	Het
Tenm4	A	T	7: 96,895,223	K2149*	probably null	Het
Ubc	T	A	5: 125,388,174	I30F	probably damaging	Het
Ugt1a7c	A	T	1: 88,095,528	E136D	possibly damaging	Het
Utp20	A	G	10: 88,754,475		probably null	Het
Vmn1r159	C	T	7: 22,842,864	V248I	probably damaging	Het
Vmn2r105	T	C	17: 20,208,612	H734R	probably damaging	Het
Wdr60	T	C	12: 116,211,891	M889V	probably benign	Het
Xrcc2	T	G	5: 25,692,709	I81L	possibly damaging	Het
Zfat	A	C	15: 68,181,015	I310S	probably damaging	Het
Zfp119a	A	G	17: 55,866,009	V278A	probably benign	Het
Zfp53	A	G	17: 21,500,246	K33E	probably benign	Het
Zfp866	G	T	8: 69,765,841	H376Q	probably damaging	Het

Other mutations in Otog

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Otog	APN	7	46251282	missense	probably damaging	1.00
IGL00725:Otog	APN	7	46274092	missense	probably damaging	1.00
IGL00757:Otog	APN	7	46290128	missense	probably damaging	1.00
IGL00822:Otog	APN	7	46295880	missense	probably benign	0.24
IGL01354:Otog	APN	7	46289726	missense	probably damaging	1.00
IGL01567:Otog	APN	7	46276615	splice site	probably benign
IGL02034:Otog	APN	7	46295993	nonsense	probably null
IGL02090:Otog	APN	7	46300147	missense	probably damaging	1.00
IGL02132:Otog	APN	7	46305479	missense	probably damaging	0.99
IGL02148:Otog	APN	7	46300587	missense	probably damaging	1.00
IGL02173:Otog	APN	7	46276741	splice site	probably benign
IGL02199:Otog	APN	7	46277351	missense	possibly damaging	0.90
IGL02216:Otog	APN	7	46301468	missense	probably damaging	1.00
IGL02322:Otog	APN	7	46301457	missense	probably benign	0.01
IGL02330:Otog	APN	7	46288069	missense	possibly damaging	0.84
IGL02529:Otog	APN	7	46259957	missense	probably damaging	0.99
IGL02898:Otog	APN	7	46310138	missense	probably damaging	1.00
IGL02970:Otog	APN	7	46295867	missense	probably benign	0.11
IGL03085:Otog	APN	7	46305922	critical splice donor site	probably null
IGL03108:Otog	APN	7	46251338	missense	probably damaging	1.00
IGL03275:Otog	APN	7	46306230	missense	probably damaging	1.00
R0282_Otog_616	UTSW	7	46277493	missense	possibly damaging	0.93
R0636_otog_678	UTSW	7	46264228	critical splice donor site	probably null
R1029_otog_141	UTSW	7	46274595	missense	probably damaging	1.00
BB010:Otog	UTSW	7	46310147	missense	probably damaging	1.00
BB020:Otog	UTSW	7	46310147	missense	probably damaging	1.00
I1329:Otog	UTSW	7	46246503	missense	probably benign	0.02
IGL02984:Otog	UTSW	7	46305508	missense	probably damaging	0.98
PIT4472001:Otog	UTSW	7	46295849	missense	probably damaging	1.00
R0032:Otog	UTSW	7	46288213	nonsense	probably null
R0032:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0105:Otog	UTSW	7	46288366	missense	possibly damaging	0.79
R0164:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0164:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0165:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0166:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0167:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0240:Otog	UTSW	7	46264032	splice site	probably null
R0240:Otog	UTSW	7	46264032	splice site	probably null
R0242:Otog	UTSW	7	46267381	missense	probably damaging	0.98
R0242:Otog	UTSW	7	46267381	missense	probably damaging	0.98
R0282:Otog	UTSW	7	46277493	missense	possibly damaging	0.93
R0392:Otog	UTSW	7	46250075	missense	probably benign	0.00
R0436:Otog	UTSW	7	46265936	splice site	probably benign
R0441:Otog	UTSW	7	46305877	missense	probably damaging	1.00
R0499:Otog	UTSW	7	46273832	missense	probably damaging	1.00
R0530:Otog	UTSW	7	46298244	missense	probably damaging	0.98
R0541:Otog	UTSW	7	46269249	splice site	probably benign
R0600:Otog	UTSW	7	46251395	splice site	probably benign
R0626:Otog	UTSW	7	46271373	missense	possibly damaging	0.95
R0636:Otog	UTSW	7	46264228	critical splice donor site	probably null
R0764:Otog	UTSW	7	46300494	missense	probably benign	0.00
R0833:Otog	UTSW	7	46269362	missense	possibly damaging	0.94
R0836:Otog	UTSW	7	46269362	missense	possibly damaging	0.94
R0844:Otog	UTSW	7	46287828	missense	possibly damaging	0.53
R1029:Otog	UTSW	7	46274595	missense	probably damaging	1.00
R1116:Otog	UTSW	7	46300601	splice site	probably benign
R1134:Otog	UTSW	7	46298514	missense	probably damaging	1.00
R1183:Otog	UTSW	7	46289755	missense	probably benign	0.41
R1204:Otog	UTSW	7	46259911	missense	probably benign	0.16
R1301:Otog	UTSW	7	46289689	missense	probably damaging	1.00
R1344:Otog	UTSW	7	46274615	missense	probably damaging	1.00
R1384:Otog	UTSW	7	46273695	splice site	probably benign
R1418:Otog	UTSW	7	46274615	missense	probably damaging	1.00
R1432:Otog	UTSW	7	46300583	missense	probably damaging	1.00
R1479:Otog	UTSW	7	46295978	missense	possibly damaging	0.75
R1521:Otog	UTSW	7	46259264	missense	possibly damaging	0.71
R1589:Otog	UTSW	7	46283908	missense	probably benign	0.18
R1671:Otog	UTSW	7	46261786	missense	probably damaging	1.00
R1773:Otog	UTSW	7	46288159	missense	probably benign	0.28
R1806:Otog	UTSW	7	46290937	critical splice acceptor site	probably null
R1843:Otog	UTSW	7	46246283	missense	probably damaging	1.00
R1873:Otog	UTSW	7	46269343	missense	probably damaging	1.00
R1923:Otog	UTSW	7	46246283	missense	probably damaging	1.00
R1927:Otog	UTSW	7	46246283	missense	probably damaging	1.00
R2008:Otog	UTSW	7	46264074	missense	probably benign	0.43
R2048:Otog	UTSW	7	46287639	missense	probably damaging	1.00
R2131:Otog	UTSW	7	46250100	missense	probably damaging	1.00
R2153:Otog	UTSW	7	46302904	missense	probably damaging	1.00
R2240:Otog	UTSW	7	46241029	start codon destroyed	probably null
R2278:Otog	UTSW	7	46300044	missense	probably damaging	1.00
R2407:Otog	UTSW	7	46241540	missense	probably benign	0.10
R2424:Otog	UTSW	7	46298169	nonsense	probably null
R2513:Otog	UTSW	7	46305590	critical splice donor site	probably null
R2863:Otog	UTSW	7	46269306	missense	probably damaging	1.00
R3148:Otog	UTSW	7	46290169	missense	probably damaging	1.00
R3732:Otog	UTSW	7	46288368	missense	probably benign	0.03
R3732:Otog	UTSW	7	46288368	missense	probably benign	0.03
R3733:Otog	UTSW	7	46288368	missense	probably benign	0.03
R3734:Otog	UTSW	7	46288368	missense	probably benign	0.03
R3855:Otog	UTSW	7	46273760	missense	possibly damaging	0.65
R3880:Otog	UTSW	7	46288021	missense	possibly damaging	0.93
R4081:Otog	UTSW	7	46288299	missense	possibly damaging	0.92
R4349:Otog	UTSW	7	46274189	missense	probably damaging	0.99
R4382:Otog	UTSW	7	46289698	missense	probably damaging	1.00
R4392:Otog	UTSW	7	46285124	missense	probably damaging	0.98
R4520:Otog	UTSW	7	46241053	unclassified	probably benign
R4569:Otog	UTSW	7	46310147	missense	probably damaging	1.00
R4580:Otog	UTSW	7	46287801	missense	possibly damaging	0.78
R4672:Otog	UTSW	7	46289786	missense	probably damaging	0.98
R4764:Otog	UTSW	7	46288519	missense	probably benign	0.29
R4910:Otog	UTSW	7	46264062	missense	probably damaging	1.00
R4910:Otog	UTSW	7	46298534	missense	probably damaging	1.00
R4913:Otog	UTSW	7	46264102	missense	probably benign	0.31
R4975:Otog	UTSW	7	46287991	missense	probably benign	0.00
R4996:Otog	UTSW	7	46298606	missense	possibly damaging	0.51
R4996:Otog	UTSW	7	46305510	nonsense	probably null
R5116:Otog	UTSW	7	46273767	missense	probably benign	0.34
R5138:Otog	UTSW	7	46250006	missense	possibly damaging	0.61
R5169:Otog	UTSW	7	46298148	missense	probably benign	0.06
R5239:Otog	UTSW	7	46287435	missense	probably benign	0.15
R5277:Otog	UTSW	7	46246621	missense	possibly damaging	0.89
R5287:Otog	UTSW	7	46269329	missense	probably damaging	0.98
R5299:Otog	UTSW	7	46288851	missense	probably benign	0.16
R5378:Otog	UTSW	7	46255004	missense	probably damaging	1.00
R5382:Otog	UTSW	7	46249004	missense	probably damaging	1.00
R5487:Otog	UTSW	7	46288768	missense	probably benign	0.27
R5507:Otog	UTSW	7	46261699	missense	probably damaging	1.00
R5517:Otog	UTSW	7	46274571	missense	probably damaging	1.00
R5643:Otog	UTSW	7	46287447	missense	probably damaging	1.00
R5757:Otog	UTSW	7	46241121	critical splice donor site	probably null
R5910:Otog	UTSW	7	46298598	missense	possibly damaging	0.94
R6019:Otog	UTSW	7	46288950	missense	probably benign	0.00
R6150:Otog	UTSW	7	46264059	missense	possibly damaging	0.82
R6225:Otog	UTSW	7	46249034	missense	possibly damaging	0.67
R6271:Otog	UTSW	7	46252040	missense	probably damaging	1.00
R6317:Otog	UTSW	7	46301215	missense	probably damaging	1.00
R6454:Otog	UTSW	7	46305817	missense	probably damaging	1.00
R6640:Otog	UTSW	7	46261743	missense	possibly damaging	0.92
R6753:Otog	UTSW	7	46249071	missense	probably benign	0.06
R6788:Otog	UTSW	7	46298317	missense	probably damaging	1.00
R6859:Otog	UTSW	7	46273781	missense	probably damaging	0.96
R7071:Otog	UTSW	7	46267323	missense	probably damaging	1.00
R7084:Otog	UTSW	7	46298566	nonsense	probably null
R7116:Otog	UTSW	7	46298265	missense	probably damaging	0.99
R7202:Otog	UTSW	7	46288050	missense	probably damaging	0.97
R7365:Otog	UTSW	7	46298308	missense	probably damaging	1.00
R7468:Otog	UTSW	7	46264119	missense	probably benign
R7475:Otog	UTSW	7	46267276	missense	probably damaging	0.99
R7502:Otog	UTSW	7	46298615	missense	probably damaging	1.00
R7558:Otog	UTSW	7	46303160	missense	probably damaging	0.99
R7577:Otog	UTSW	7	46287855	missense	possibly damaging	0.62
R7651:Otog	UTSW	7	46241761	missense	probably benign	0.00
R7689:Otog	UTSW	7	46252056	missense	probably damaging	1.00
R7806:Otog	UTSW	7	46285776	missense	probably benign
R7933:Otog	UTSW	7	46310147	missense	probably damaging	1.00
R8021:Otog	UTSW	7	46267342	missense	probably damaging	0.98
R8082:Otog	UTSW	7	46289719	missense	probably damaging	1.00
R8531:Otog	UTSW	7	46252049	missense	probably damaging	0.99
R8772:Otog	UTSW	7	46284928	missense	probably damaging	1.00
R8816:Otog	UTSW	7	46301481	missense	possibly damaging	0.92
R8842:Otog	UTSW	7	46246524	missense	probably damaging	1.00
R8987:Otog	UTSW	7	46287454	missense	probably benign	0.43
R8988:Otog	UTSW	7	46310147	missense	probably damaging	1.00
R9010:Otog	UTSW	7	46300470	missense	probably benign	0.00
R9025:Otog	UTSW	7	46288096	missense	probably benign	0.13
R9131:Otog	UTSW	7	46303173	nonsense	probably null
R9179:Otog	UTSW	7	46288461	missense	possibly damaging	0.65
R9334:Otog	UTSW	7	46259929	missense	possibly damaging	0.95
R9365:Otog	UTSW	7	46271264	missense	probably damaging	1.00
R9408:Otog	UTSW	7	46267297	missense	possibly damaging	0.79
R9418:Otog	UTSW	7	46288600	missense	probably benign	0.41
R9465:Otog	UTSW	7	46305875	missense	possibly damaging	0.80
RF024:Otog	UTSW	7	46287669	missense	probably damaging	1.00
X0062:Otog	UTSW	7	46259921	missense	probably damaging	1.00
Z1177:Otog	UTSW	7	46262852	missense	possibly damaging	0.80
Z1177:Otog	UTSW	7	46274538	missense	probably damaging	1.00
Z1177:Otog	UTSW	7	46289740	missense	probably damaging	1.00
Z1177:Otog	UTSW	7	46309985	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGTCCTGTAGTGTGAGAAGAC -3'
(R):5'- AACCTGACAGGCTCCATTCC -3'

Sequencing Primer
(F):5'- CCTGTAGTGTGAGAAGACTTATCTGC -3'
(R):5'- ATTCCAGGCTGAGCTCTCACG -3'

Posted On

2019-05-13