Mutagenetix > Incidental Mutations

Incidental Mutation 'R7033:Sorl1'

546458

Institutional Source

Beutler Lab

Gene Symbol

Sorl1

Ensembl Gene

ENSMUSG00000049313

Gene Name

sortilin-related receptor, LDLR class A repeats-containing

Synonyms

2900010L19Rik, mSorLA, Sorla, LR11

MMRRC Submission

Accession Numbers

Genbank: NM_011436; MGI: 1202296

Is this an essential gene?

Possibly non essential (E-score: 0.366) question?

Stock #

R7033 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

41964720-42124297 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 42030983 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 982 (S982N)

Ref Sequence

ENSEMBL: ENSMUSP00000058613 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060989]

AlphaFold

O88307

Predicted Effect

possibly damaging
Transcript: ENSMUST00000060989
AA Change: S982N

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: S982N

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
VPS10	124	757	N/A	SMART
LY	780	822	9.33e-6	SMART
LY	824	866	2.38e-12	SMART
LY	867	912	1.87e-5	SMART
LY	913	953	1.08e-10	SMART
LY	954	993	5.43e0	SMART
EGF_like	1020	1072	2.8e1	SMART
LDLa	1077	1114	1.76e-14	SMART
LDLa	1116	1155	5.34e-14	SMART
LDLa	1157	1194	1.67e-15	SMART
EGF_like	1198	1236	4.93e1	SMART
LDLa	1198	1237	3.83e-15	SMART
LDLa	1238	1273	1.99e-13	SMART
LDLa	1274	1317	2.53e-6	SMART
LDLa	1324	1361	4.34e-14	SMART
LDLa	1367	1405	1.14e-13	SMART
LDLa	1418	1455	3.34e-15	SMART
LDLa	1470	1508	1.09e-10	SMART
LDLa	1513	1551	1.09e-10	SMART
FN3	1555	1638	4.19e-4	SMART
FN3	1651	1732	7.23e-8	SMART
FN3	1747	1830	4.8e0	SMART
FN3	1842	1920	3e1	SMART
FN3	1933	2016	6.01e-5	SMART
FN3	2025	2107	2.03e-2	SMART
transmembrane domain	2137	2159	N/A	INTRINSIC
low complexity region	2188	2199	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

96% (70/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]

Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700024B05Rik	A	G	14: 41,997,417	Y105C	probably damaging	Het
2610301B20Rik	A	G	4: 10,898,014	T199A	probably benign	Het
Acr	T	C	15: 89,569,500	S81P	probably benign	Het
Akr1c14	T	C	13: 4,079,178		probably null	Het
Ank2	C	A	3: 126,944,850	E2375*	probably null	Het
Avpi1	A	G	19: 42,124,977	W14R	probably damaging	Het
Brd4	A	G	17: 32,199,015	V55A	probably benign	Het
Casp8ap2	A	G	4: 32,639,392	N149D	probably damaging	Het
Ccl25	A	T	8: 4,349,641		probably benign	Het
Celf5	A	G	10: 81,462,714	L299P	probably damaging	Het
Cfap57	T	G	4: 118,613,126	T186P	possibly damaging	Het
Chrm4	A	G	2: 91,928,347	M367V	probably benign	Het
Col1a2	A	T	6: 4,516,904		probably benign	Het
Crybg3	G	A	16: 59,554,165	P2242L	probably damaging	Het
Cspg4	T	C	9: 56,888,074	V1031A	probably damaging	Het
Dbnl	C	A	11: 5,798,102	P313T	probably benign	Het
Dnah1	A	G	14: 31,264,925	F3637L	probably damaging	Het
Dnah7a	A	T	1: 53,479,661	I2979N	probably damaging	Het
Dusp10	T	C	1: 184,037,605	V256A	possibly damaging	Het
Erlin2	T	C	8: 27,031,764	V164A	probably benign	Het
Fam110a	T	C	2: 151,970,211	D213G	probably damaging	Het
Fkbp1a	T	C	2: 151,557,500		probably null	Het
Foxg1	G	A	12: 49,384,720		probably benign	Het
Gm12185	T	C	11: 48,915,999	S122G	probably benign	Het
Gm2042	A	T	12: 87,960,281	D456V	probably damaging	Het
Gm8857	G	T	5: 10,950,551		probably null	Het
Grin2b	A	G	6: 135,923,038	Y282H	probably damaging	Het
Gys2	T	C	6: 142,472,722	D27G	probably benign	Het
H2-DMa	T	A	17: 34,136,997		probably null	Het
Hectd4	T	A	5: 121,364,568	I4245N	possibly damaging	Het
Incenp	A	G	19: 9,893,372	Y298H	unknown	Het
Ints2	C	T	11: 86,233,085	G626R	probably damaging	Het
Kifc1	A	T	17: 33,883,697	V314E	probably damaging	Het
Lurap1l	C	T	4: 80,911,367	P5S	probably benign	Het
Mtmr11	A	G	3: 96,169,946	Y540C	probably damaging	Het
Muc4	C	A	16: 32,756,324		probably benign	Het
Myh13	A	G	11: 67,369,316	E1860G	possibly damaging	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Nbeal1	G	A	1: 60,310,947	G2385D	probably damaging	Het
Ncaph2	G	A	15: 89,371,356	A578T	probably benign	Het
Ncr1	T	C	7: 4,338,145	V8A	possibly damaging	Het
Nutm1	T	C	2: 112,256,168	T73A	probably damaging	Het
Olfm1	G	A	2: 28,229,336	D313N	probably damaging	Het
Olfr1196	T	A	2: 88,700,820	N170Y	probably damaging	Het
Olfr275	A	G	4: 52,826,089	M231V	probably benign	Het
Olfr749	A	G	14: 50,736,707	F152L	possibly damaging	Het
Otog	T	A	7: 46,267,398		probably null	Het
Peak1	G	T	9: 56,259,707	D312E	probably damaging	Het
Plekhg1	T	C	10: 3,940,251	I331T	probably damaging	Het
Polr1b	T	C	2: 129,115,642	V539A	possibly damaging	Het
Polr2a	A	T	11: 69,747,213	H143Q	possibly damaging	Het
Ppargc1b	G	T	18: 61,307,714	A711D	probably damaging	Het
Prnd	T	A	2: 131,953,442	C161S	possibly damaging	Het
Prrt4	A	G	6: 29,171,148	L435P	possibly damaging	Het
Psen2	C	T	1: 180,227,520		probably null	Het
Psg23	T	C	7: 18,614,744	E46G	possibly damaging	Het
Rasgef1b	C	T	5: 99,232,336	R350H	probably damaging	Het
Rfxank	G	C	8: 70,138,170	P16A	probably benign	Het
Sema6a	A	G	18: 47,248,570	I944T	probably damaging	Het
Serpinc1	A	G	1: 160,997,521	T313A	probably benign	Het
Slc27a4	T	C	2: 29,804,271	S36P	possibly damaging	Het
Slc36a1	C	A	11: 55,223,737	R214S	probably benign	Het
Syt1	A	C	10: 108,690,936	D37E	probably benign	Het
Tcl1b5	A	T	12: 105,176,491	D26V	probably damaging	Het
Tenm4	A	T	7: 96,895,223	K2149*	probably null	Het
Ubc	T	A	5: 125,388,174	I30F	probably damaging	Het
Ugt1a7c	A	T	1: 88,095,528	E136D	possibly damaging	Het
Utp20	A	G	10: 88,754,475		probably null	Het
Vmn1r159	C	T	7: 22,842,864	V248I	probably damaging	Het
Vmn2r105	T	C	17: 20,208,612	H734R	probably damaging	Het
Wdr60	T	C	12: 116,211,891	M889V	probably benign	Het
Xrcc2	T	G	5: 25,692,709	I81L	possibly damaging	Het
Zfat	A	C	15: 68,181,015	I310S	probably damaging	Het
Zfp119a	A	G	17: 55,866,009	V278A	probably benign	Het
Zfp53	A	G	17: 21,500,246	K33E	probably benign	Het
Zfp866	G	T	8: 69,765,841	H376Q	probably damaging	Het

Other mutations in Sorl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Sorl1	APN	9	41974094	missense	probably damaging	1.00
IGL01303:Sorl1	APN	9	42024478	splice site	probably benign
IGL01545:Sorl1	APN	9	42043956	missense	probably damaging	1.00
IGL01629:Sorl1	APN	9	42057269	critical splice donor site	probably null
IGL01670:Sorl1	APN	9	42001492	missense	possibly damaging	0.81
IGL01684:Sorl1	APN	9	41980711	missense	probably damaging	0.96
IGL02154:Sorl1	APN	9	42004034	missense	probably benign
IGL02215:Sorl1	APN	9	42018182	missense	probably damaging	0.97
IGL02427:Sorl1	APN	9	42041690	missense	probably damaging	1.00
IGL02590:Sorl1	APN	9	42046561	missense	probably benign	0.01
IGL02794:Sorl1	APN	9	42063774	missense	probably damaging	0.98
IGL02797:Sorl1	APN	9	42037059	missense	probably damaging	0.99
IGL02987:Sorl1	APN	9	42041053	missense	probably damaging	1.00
IGL03005:Sorl1	APN	9	42057325	missense	probably damaging	1.00
IGL03069:Sorl1	APN	9	41991426	missense	probably benign
IGL03288:Sorl1	APN	9	42033562	splice site	probably benign
N/A - 287:Sorl1	UTSW	9	42041596	nonsense	probably null
PIT4151001:Sorl1	UTSW	9	41968622	missense	probably damaging	1.00
R0117:Sorl1	UTSW	9	42033577	missense	probably benign	0.10
R0173:Sorl1	UTSW	9	42067933	missense	probably damaging	0.99
R0318:Sorl1	UTSW	9	42081954	missense	probably damaging	1.00
R0385:Sorl1	UTSW	9	42031909	missense	probably damaging	0.99
R0448:Sorl1	UTSW	9	42004088	missense	probably damaging	1.00
R0492:Sorl1	UTSW	9	41991371	missense	probably null	0.00
R0512:Sorl1	UTSW	9	42067832	missense	probably benign	0.01
R0587:Sorl1	UTSW	9	41984506	missense	probably damaging	1.00
R0600:Sorl1	UTSW	9	42043900	splice site	probably benign
R0831:Sorl1	UTSW	9	42071069	splice site	probably benign
R0924:Sorl1	UTSW	9	42008174	splice site	probably benign
R1013:Sorl1	UTSW	9	42002559	missense	probably benign	0.00
R1053:Sorl1	UTSW	9	41991456	missense	probably benign
R1077:Sorl1	UTSW	9	42014490	missense	probably damaging	1.00
R1326:Sorl1	UTSW	9	42031796	missense	probably benign	0.14
R1348:Sorl1	UTSW	9	42000412	splice site	probably null
R1498:Sorl1	UTSW	9	42041073	missense	probably damaging	1.00
R1671:Sorl1	UTSW	9	41974000	missense	probably damaging	1.00
R1713:Sorl1	UTSW	9	41996242	missense	probably benign	0.06
R1738:Sorl1	UTSW	9	42089965	missense	probably benign	0.33
R1779:Sorl1	UTSW	9	41991482	critical splice acceptor site	probably null
R1871:Sorl1	UTSW	9	41969725	nonsense	probably null
R1912:Sorl1	UTSW	9	42081950	missense	probably damaging	1.00
R1952:Sorl1	UTSW	9	42046624	missense	probably benign
R2071:Sorl1	UTSW	9	41979457	missense	possibly damaging	0.71
R2153:Sorl1	UTSW	9	41984492	missense	probably benign	0.01
R2417:Sorl1	UTSW	9	41980711	missense	probably damaging	0.96
R2429:Sorl1	UTSW	9	42037070	missense	probably damaging	1.00
R2866:Sorl1	UTSW	9	41969781	missense	probably benign
R3815:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3816:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3817:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3819:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3890:Sorl1	UTSW	9	42004105	missense	probably damaging	1.00
R3941:Sorl1	UTSW	9	41989468	critical splice acceptor site	probably null
R4409:Sorl1	UTSW	9	42035448	missense	probably damaging	0.99
R4410:Sorl1	UTSW	9	42003992	nonsense	probably null
R4610:Sorl1	UTSW	9	42031914	missense	possibly damaging	0.65
R4664:Sorl1	UTSW	9	42004051	missense	probably damaging	0.97
R4666:Sorl1	UTSW	9	42004051	missense	probably damaging	0.97
R4668:Sorl1	UTSW	9	41984508	missense	probably damaging	1.00
R4823:Sorl1	UTSW	9	41992321	missense	probably damaging	1.00
R4874:Sorl1	UTSW	9	42063752	missense	probably damaging	0.99
R4898:Sorl1	UTSW	9	42041639	missense	probably damaging	1.00
R4922:Sorl1	UTSW	9	42014450	splice site	probably null
R4976:Sorl1	UTSW	9	41983003	missense	probably benign	0.00
R4984:Sorl1	UTSW	9	41991342	missense	probably damaging	1.00
R5046:Sorl1	UTSW	9	41996294	missense	probably benign
R5070:Sorl1	UTSW	9	42031818	missense	possibly damaging	0.82
R5084:Sorl1	UTSW	9	41976377	missense	probably benign	0.01
R5202:Sorl1	UTSW	9	42033583	missense	probably benign	0.00
R5265:Sorl1	UTSW	9	42106516	missense	possibly damaging	0.80
R5275:Sorl1	UTSW	9	42030902	missense	probably benign	0.33
R5368:Sorl1	UTSW	9	41979390	missense	probably benign	0.00
R5385:Sorl1	UTSW	9	42057284	missense	possibly damaging	0.83
R5386:Sorl1	UTSW	9	42057284	missense	possibly damaging	0.83
R5416:Sorl1	UTSW	9	42002636	nonsense	probably null
R5518:Sorl1	UTSW	9	42037212	missense	possibly damaging	0.92
R5545:Sorl1	UTSW	9	41991625	missense	probably benign	0.08
R5864:Sorl1	UTSW	9	42092373	missense	probably damaging	1.00
R5865:Sorl1	UTSW	9	41983034	missense	possibly damaging	0.94
R6339:Sorl1	UTSW	9	41969742	missense	probably benign	0.10
R6484:Sorl1	UTSW	9	41976407	missense	probably damaging	1.00
R6505:Sorl1	UTSW	9	42071234	missense	probably damaging	1.00
R6591:Sorl1	UTSW	9	42002567	missense	probably damaging	1.00
R6596:Sorl1	UTSW	9	42001603	missense	possibly damaging	0.81
R6654:Sorl1	UTSW	9	41980645	missense	possibly damaging	0.47
R6691:Sorl1	UTSW	9	42002567	missense	probably damaging	1.00
R6702:Sorl1	UTSW	9	42071201	missense	probably damaging	0.97
R6703:Sorl1	UTSW	9	42071201	missense	probably damaging	0.97
R6775:Sorl1	UTSW	9	42092452	missense	possibly damaging	0.93
R6792:Sorl1	UTSW	9	42099263	missense	probably damaging	1.00
R6852:Sorl1	UTSW	9	42024398	missense	possibly damaging	0.90
R6860:Sorl1	UTSW	9	42022392	missense	probably benign	0.01
R6925:Sorl1	UTSW	9	42033626	missense	probably damaging	1.00
R7022:Sorl1	UTSW	9	41969751	missense	probably benign	0.11
R7091:Sorl1	UTSW	9	42002634	missense	probably benign	0.00
R7267:Sorl1	UTSW	9	42124079	missense	possibly damaging	0.63
R7269:Sorl1	UTSW	9	42037203	missense	probably damaging	0.99
R7272:Sorl1	UTSW	9	42063710	splice site	probably null
R7537:Sorl1	UTSW	9	41980688	missense	probably benign	0.01
R7615:Sorl1	UTSW	9	41977582	missense	possibly damaging	0.91
R7636:Sorl1	UTSW	9	42092334	missense	possibly damaging	0.90
R7727:Sorl1	UTSW	9	41984526	missense	probably damaging	1.00
R7763:Sorl1	UTSW	9	42043909	missense	probably damaging	1.00
R7831:Sorl1	UTSW	9	42089961	missense	probably benign	0.17
R7956:Sorl1	UTSW	9	41989359	missense	probably damaging	1.00
R7964:Sorl1	UTSW	9	41991401	missense	probably damaging	1.00
R7977:Sorl1	UTSW	9	41977561	missense	probably damaging	1.00
R7987:Sorl1	UTSW	9	41977561	missense	probably damaging	1.00
R8151:Sorl1	UTSW	9	42067933	missense	probably damaging	0.99
R8219:Sorl1	UTSW	9	42041561	splice site	probably null
R8261:Sorl1	UTSW	9	42014481	missense	probably damaging	1.00
R8283:Sorl1	UTSW	9	42030998	missense	probably damaging	1.00
R8308:Sorl1	UTSW	9	42018160	missense	probably damaging	1.00
R8348:Sorl1	UTSW	9	41991745	missense	probably benign	0.35
R8448:Sorl1	UTSW	9	41991745	missense	probably benign	0.35
R8524:Sorl1	UTSW	9	41974074	missense	probably damaging	1.00
R8869:Sorl1	UTSW	9	42022426	missense	probably benign	0.01
R8898:Sorl1	UTSW	9	42000271	missense	probably damaging	1.00
R8972:Sorl1	UTSW	9	42046552	missense	probably damaging	1.00
R9012:Sorl1	UTSW	9	42071195	missense	probably damaging	1.00
R9094:Sorl1	UTSW	9	42063754	missense	possibly damaging	0.92
R9241:Sorl1	UTSW	9	41974124	nonsense	probably null
R9278:Sorl1	UTSW	9	42046561	missense	probably benign	0.01
R9288:Sorl1	UTSW	9	42041631	missense	probably damaging	1.00
R9303:Sorl1	UTSW	9	41989443	missense	probably damaging	1.00
R9330:Sorl1	UTSW	9	42067933	missense	probably damaging	1.00
R9332:Sorl1	UTSW	9	42001518	missense	probably damaging	1.00
Z1176:Sorl1	UTSW	9	42099203	missense	possibly damaging	0.64
Z1176:Sorl1	UTSW	9	42123948	missense	probably benign	0.03
Z1177:Sorl1	UTSW	9	41991638	missense	possibly damaging	0.92
Z1177:Sorl1	UTSW	9	42106541	missense	probably benign	0.00
Z1177:Sorl1	UTSW	9	42123912	missense	probably damaging	1.00
Z31818:Sorl1	UTSW	9	42041596	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TTTGCAGCCCCTTTCTAGAG -3'
(R):5'- CTAGGTCATTTCTTCCTGAGGG -3'

Sequencing Primer
(F):5'- CCTTTCTAGAGACCAAGTCTGG -3'
(R):5'- GCCGTTGGTGAGGTTTCAATAAAAC -3'

Posted On

2019-05-13