Mutagenetix > Incidental Mutation

Incidental Mutation 'R7033:Ppargc1b'

546490

Institutional Source

Beutler Lab

Gene Symbol

Ppargc1b

Ensembl Gene

ENSMUSG00000033871

Gene Name

peroxisome proliferative activated receptor, gamma, coactivator 1 beta

Synonyms

PGC-1beta/ERRL1, 4631412G21Rik

MMRRC Submission

045134-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.330) question?

Stock #

R7033 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

61298136-61400431 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 61307714 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Aspartic acid at position 711 (A711D)

Ref Sequence

ENSEMBL: ENSMUSP00000069431 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063307] [ENSMUST00000075299]

AlphaFold

Q8VHJ7

Predicted Effect

probably damaging
Transcript: ENSMUST00000063307
AA Change: A711D

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000069431
Gene: ENSMUSG00000033871
AA Change: A711D

Domain	Start	End	E-Value	Type
low complexity region	3	17	N/A	INTRINSIC
low complexity region	107	112	N/A	INTRINSIC
low complexity region	137	156	N/A	INTRINSIC
low complexity region	169	189	N/A	INTRINSIC
coiled coil region	437	472	N/A	INTRINSIC
low complexity region	613	619	N/A	INTRINSIC
low complexity region	640	656	N/A	INTRINSIC
low complexity region	799	833	N/A	INTRINSIC
low complexity region	852	872	N/A	INTRINSIC
RRM	910	980	8.87e-7	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075299
AA Change: A695D

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000074771
Gene: ENSMUSG00000033871
AA Change: A695D

Domain	Start	End	E-Value	Type
low complexity region	91	96	N/A	INTRINSIC
low complexity region	121	140	N/A	INTRINSIC
low complexity region	153	173	N/A	INTRINSIC
coiled coil region	421	456	N/A	INTRINSIC
low complexity region	597	603	N/A	INTRINSIC
low complexity region	624	640	N/A	INTRINSIC
low complexity region	783	817	N/A	INTRINSIC
low complexity region	836	856	N/A	INTRINSIC
RRM	894	964	8.87e-7	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

96% (70/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene stimulates the activity of several transcription factors and nuclear receptors, including estrogen receptor alpha, nuclear respiratory factor 1, and glucocorticoid receptor. The encoded protein may be involved in fat oxidation, non-oxidative glucose metabolism, and the regulation of energy expenditure. This protein is downregulated in prediabetic and type 2 diabetes mellitus patients. Certain allelic variations in this gene increase the risk of the development of obesity. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous inactivation of this gene can lead to postnatal lethality and impaired mitochondrial activity, adaptive thermogenesis, and hepatic function. Homozygotes for a null allele also display a defect in heart rate regulation, reduced body weight and WAT content, and increased energy expenditure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700024B05Rik	A	G	14: 41,997,417	Y105C	probably damaging	Het
2610301B20Rik	A	G	4: 10,898,014	T199A	probably benign	Het
Acr	T	C	15: 89,569,500	S81P	probably benign	Het
Akr1c14	T	C	13: 4,079,178		probably null	Het
Ank2	C	A	3: 126,944,850	E2375*	probably null	Het
Avpi1	A	G	19: 42,124,977	W14R	probably damaging	Het
Brd4	A	G	17: 32,199,015	V55A	probably benign	Het
Casp8ap2	A	G	4: 32,639,392	N149D	probably damaging	Het
Ccl25	A	T	8: 4,349,641		probably benign	Het
Celf5	A	G	10: 81,462,714	L299P	probably damaging	Het
Cfap57	T	G	4: 118,613,126	T186P	possibly damaging	Het
Chrm4	A	G	2: 91,928,347	M367V	probably benign	Het
Col1a2	A	T	6: 4,516,904		probably benign	Het
Crybg3	G	A	16: 59,554,165	P2242L	probably damaging	Het
Cspg4	T	C	9: 56,888,074	V1031A	probably damaging	Het
Dbnl	C	A	11: 5,798,102	P313T	probably benign	Het
Dnah1	A	G	14: 31,264,925	F3637L	probably damaging	Het
Dnah7a	A	T	1: 53,479,661	I2979N	probably damaging	Het
Dusp10	T	C	1: 184,037,605	V256A	possibly damaging	Het
Erlin2	T	C	8: 27,031,764	V164A	probably benign	Het
Fam110a	T	C	2: 151,970,211	D213G	probably damaging	Het
Fkbp1a	T	C	2: 151,557,500		probably null	Het
Foxg1	G	A	12: 49,384,720		probably benign	Het
Gm12185	T	C	11: 48,915,999	S122G	probably benign	Het
Gm2042	A	T	12: 87,960,281	D456V	probably damaging	Het
Gm8857	G	T	5: 10,950,551		probably null	Het
Grin2b	A	G	6: 135,923,038	Y282H	probably damaging	Het
Gys2	T	C	6: 142,472,722	D27G	probably benign	Het
H2-DMa	T	A	17: 34,136,997		probably null	Het
Hectd4	T	A	5: 121,364,568	I4245N	possibly damaging	Het
Incenp	A	G	19: 9,893,372	Y298H	unknown	Het
Ints2	C	T	11: 86,233,085	G626R	probably damaging	Het
Kifc1	A	T	17: 33,883,697	V314E	probably damaging	Het
Lurap1l	C	T	4: 80,911,367	P5S	probably benign	Het
Mtmr11	A	G	3: 96,169,946	Y540C	probably damaging	Het
Muc4	C	A	16: 32,756,324		probably benign	Het
Myh13	A	G	11: 67,369,316	E1860G	possibly damaging	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Nbeal1	G	A	1: 60,310,947	G2385D	probably damaging	Het
Ncaph2	G	A	15: 89,371,356	A578T	probably benign	Het
Ncr1	T	C	7: 4,338,145	V8A	possibly damaging	Het
Nutm1	T	C	2: 112,256,168	T73A	probably damaging	Het
Olfm1	G	A	2: 28,229,336	D313N	probably damaging	Het
Olfr1196	T	A	2: 88,700,820	N170Y	probably damaging	Het
Olfr275	A	G	4: 52,826,089	M231V	probably benign	Het
Olfr749	A	G	14: 50,736,707	F152L	possibly damaging	Het
Otog	T	A	7: 46,267,398		probably null	Het
Peak1	G	T	9: 56,259,707	D312E	probably damaging	Het
Plekhg1	T	C	10: 3,940,251	I331T	probably damaging	Het
Polr1b	T	C	2: 129,115,642	V539A	possibly damaging	Het
Polr2a	A	T	11: 69,747,213	H143Q	possibly damaging	Het
Prnd	T	A	2: 131,953,442	C161S	possibly damaging	Het
Prrt4	A	G	6: 29,171,148	L435P	possibly damaging	Het
Psen2	C	T	1: 180,227,520		probably null	Het
Psg23	T	C	7: 18,614,744	E46G	possibly damaging	Het
Rasgef1b	C	T	5: 99,232,336	R350H	probably damaging	Het
Rfxank	G	C	8: 70,138,170	P16A	probably benign	Het
Sema6a	A	G	18: 47,248,570	I944T	probably damaging	Het
Serpinc1	A	G	1: 160,997,521	T313A	probably benign	Het
Slc27a4	T	C	2: 29,804,271	S36P	possibly damaging	Het
Slc36a1	C	A	11: 55,223,737	R214S	probably benign	Het
Sorl1	C	T	9: 42,030,983	S982N	possibly damaging	Het
Syt1	A	C	10: 108,690,936	D37E	probably benign	Het
Tcl1b5	A	T	12: 105,176,491	D26V	probably damaging	Het
Tenm4	A	T	7: 96,895,223	K2149*	probably null	Het
Ubc	T	A	5: 125,388,174	I30F	probably damaging	Het
Ugt1a7c	A	T	1: 88,095,528	E136D	possibly damaging	Het
Utp20	A	G	10: 88,754,475		probably null	Het
Vmn1r159	C	T	7: 22,842,864	V248I	probably damaging	Het
Vmn2r105	T	C	17: 20,208,612	H734R	probably damaging	Het
Wdr60	T	C	12: 116,211,891	M889V	probably benign	Het
Xrcc2	T	G	5: 25,692,709	I81L	possibly damaging	Het
Zfat	A	C	15: 68,181,015	I310S	probably damaging	Het
Zfp119a	A	G	17: 55,866,009	V278A	probably benign	Het
Zfp53	A	G	17: 21,500,246	K33E	probably benign	Het
Zfp866	G	T	8: 69,765,841	H376Q	probably damaging	Het

Other mutations in Ppargc1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00965:Ppargc1b	APN	18	61323164	missense	probably damaging	1.00
IGL02160:Ppargc1b	APN	18	61310435	missense	probably damaging	1.00
IGL02176:Ppargc1b	APN	18	61310875	nonsense	probably null
IGL02176:Ppargc1b	APN	18	61310874	missense	probably damaging	1.00
IGL02183:Ppargc1b	APN	18	61309096	critical splice acceptor site	probably null
IGL02386:Ppargc1b	APN	18	61323151	missense	probably damaging	1.00
IGL02620:Ppargc1b	APN	18	61298739	missense	probably damaging	1.00
IGL02688:Ppargc1b	APN	18	61312243	missense	possibly damaging	0.94
IGL02801:Ppargc1b	APN	18	61307684	missense	possibly damaging	0.77
IGL02970:Ppargc1b	APN	18	61298766	missense	probably damaging	1.00
R0033:Ppargc1b	UTSW	18	61307694	missense	probably damaging	1.00
R0139:Ppargc1b	UTSW	18	61315963	splice site	probably benign
R0194:Ppargc1b	UTSW	18	61307945	missense	possibly damaging	0.94
R0412:Ppargc1b	UTSW	18	61315861	missense	probably damaging	0.99
R0574:Ppargc1b	UTSW	18	61302739	missense	probably benign	0.34
R0576:Ppargc1b	UTSW	18	61311441	missense	probably damaging	0.98
R1546:Ppargc1b	UTSW	18	61310606	missense	probably damaging	1.00
R1721:Ppargc1b	UTSW	18	61307204	splice site	probably null
R1758:Ppargc1b	UTSW	18	61298786	splice site	probably null
R1951:Ppargc1b	UTSW	18	61298777	missense	possibly damaging	0.55
R2110:Ppargc1b	UTSW	18	61311250	missense	probably benign	0.00
R2112:Ppargc1b	UTSW	18	61311250	missense	probably benign	0.00
R2212:Ppargc1b	UTSW	18	61311220	nonsense	probably null
R2432:Ppargc1b	UTSW	18	61307799	missense	possibly damaging	0.93
R3612:Ppargc1b	UTSW	18	61310556	missense	probably benign	0.07
R3848:Ppargc1b	UTSW	18	61311042	missense	probably damaging	1.00
R3913:Ppargc1b	UTSW	18	61311376	missense	probably damaging	0.99
R4328:Ppargc1b	UTSW	18	61382469	nonsense	probably null
R4502:Ppargc1b	UTSW	18	61302679	missense	probably benign	0.39
R4762:Ppargc1b	UTSW	18	61311257	missense	possibly damaging	0.93
R5032:Ppargc1b	UTSW	18	61307265	missense	probably damaging	1.00
R5111:Ppargc1b	UTSW	18	61310487	missense	probably damaging	1.00
R5119:Ppargc1b	UTSW	18	61307654	missense	probably benign	0.38
R5164:Ppargc1b	UTSW	18	61302644	missense	probably damaging	1.00
R5266:Ppargc1b	UTSW	18	61315805	missense	probably damaging	1.00
R5350:Ppargc1b	UTSW	18	61309063	missense	possibly damaging	0.78
R5478:Ppargc1b	UTSW	18	61307568	missense	probably benign
R5719:Ppargc1b	UTSW	18	61307568	missense	probably benign
R5876:Ppargc1b	UTSW	18	61309093	missense	probably damaging	0.99
R5877:Ppargc1b	UTSW	18	61309093	missense	probably damaging	0.99
R5879:Ppargc1b	UTSW	18	61309093	missense	probably damaging	0.99
R5967:Ppargc1b	UTSW	18	61298766	missense	probably damaging	1.00
R6030:Ppargc1b	UTSW	18	61307934	nonsense	probably null
R6030:Ppargc1b	UTSW	18	61307934	nonsense	probably null
R6135:Ppargc1b	UTSW	18	61315909	missense	probably damaging	0.99
R6533:Ppargc1b	UTSW	18	61307774	missense	possibly damaging	0.93
R6791:Ppargc1b	UTSW	18	61307676	missense	probably damaging	1.00
R6792:Ppargc1b	UTSW	18	61307676	missense	probably damaging	1.00
R7316:Ppargc1b	UTSW	18	61307838	missense	probably damaging	0.97
R7560:Ppargc1b	UTSW	18	61312210	missense	probably damaging	1.00
R8007:Ppargc1b	UTSW	18	61310494	missense	possibly damaging	0.55
R8374:Ppargc1b	UTSW	18	61310493	missense	probably damaging	0.99
R9072:Ppargc1b	UTSW	18	61310659	missense	probably damaging	1.00
R9073:Ppargc1b	UTSW	18	61310659	missense	probably damaging	1.00
R9178:Ppargc1b	UTSW	18	61310922	missense	probably benign	0.06
R9339:Ppargc1b	UTSW	18	61323196	missense	probably damaging	1.00
R9357:Ppargc1b	UTSW	18	61315868	missense	probably damaging	0.99
R9406:Ppargc1b	UTSW	18	61310980	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- ACGGATCTCATGGTCTCTTAGC -3'
(R):5'- TCCATACAAGCCAATGGAGGAG -3'

Sequencing Primer
(F):5'- ATGGTCTCTTAGCTGCATGC -3'
(R):5'- AATGGAGGAGGACCCCTTC -3'

Posted On

2019-05-13