Mutagenetix > Incidental Mutation

Incidental Mutation 'R7033:Incenp'

546491

Institutional Source

Beutler Lab

Gene Symbol

Incenp

Ensembl Gene

ENSMUSG00000024660

Gene Name

inner centromere protein

Synonyms

2700067E22Rik

MMRRC Submission

Accession Numbers

Genbank: NM_016692

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7033 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

9872297-9899533 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 9893372 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 298 (Y298H)

Ref Sequence

ENSEMBL: ENSMUSP00000025562 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025562]

AlphaFold

Q9WU62

Predicted Effect

unknown
Transcript: ENSMUST00000025562
AA Change: Y298H

SMART Domains

Protein: ENSMUSP00000025562
Gene: ENSMUSG00000024660
AA Change: Y298H

Domain	Start	End	E-Value	Type
Pfam:INCENP_N	6	41	1.9e-18	PFAM
low complexity region	83	94	N/A	INTRINSIC
low complexity region	123	145	N/A	INTRINSIC
low complexity region	308	314	N/A	INTRINSIC
low complexity region	350	367	N/A	INTRINSIC
low complexity region	434	447	N/A	INTRINSIC
low complexity region	517	553	N/A	INTRINSIC
low complexity region	557	573	N/A	INTRINSIC
SCOP:d1f5na1	631	739	7e-3	SMART
Pfam:INCENP_ARK-bind	789	846	1.5e-22	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

96% (70/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In mammalian cells, 2 broad groups of centromere-interacting proteins have been described: constitutively binding centromere proteins and 'passenger,' or transiently interacting, proteins (reviewed by Choo, 1997). The constitutive proteins include CENPA (centromere protein A; MIM 117139), CENPB (MIM 117140), CENPC1 (MIM 117141), and CENPD (MIM 117142). The term 'passenger proteins' encompasses a broad collection of proteins that localize to the centromere during specific stages of the cell cycle (Earnshaw and Mackay, 1994 [PubMed 8088460]). These include CENPE (MIM 117143); MCAK (MIM 604538); KID (MIM 603213); cytoplasmic dynein (e.g., MIM 600112); CliPs (e.g., MIM 179838); and CENPF/mitosin (MIM 600236). The inner centromere proteins (INCENPs) (Earnshaw and Cooke, 1991 [PubMed 1860899]), the initial members of the passenger protein group, display a broad localization along chromosomes in the early stages of mitosis but gradually become concentrated at centromeres as the cell cycle progresses into mid-metaphase. During telophase, the proteins are located within the midbody in the intercellular bridge, where they are discarded after cytokinesis (Cutts et al., 1999 [PubMed 10369859]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant embryos die before E8.5. Embryonic cells exhibit abnormal nuclei and abberent mitosis. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(9)

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700024B05Rik	A	G	14: 41,997,417	Y105C	probably damaging	Het
2610301B20Rik	A	G	4: 10,898,014	T199A	probably benign	Het
Acr	T	C	15: 89,569,500	S81P	probably benign	Het
Akr1c14	T	C	13: 4,079,178		probably null	Het
Ank2	C	A	3: 126,944,850	E2375*	probably null	Het
Avpi1	A	G	19: 42,124,977	W14R	probably damaging	Het
Brd4	A	G	17: 32,199,015	V55A	probably benign	Het
Casp8ap2	A	G	4: 32,639,392	N149D	probably damaging	Het
Ccl25	A	T	8: 4,349,641		probably benign	Het
Celf5	A	G	10: 81,462,714	L299P	probably damaging	Het
Cfap57	T	G	4: 118,613,126	T186P	possibly damaging	Het
Chrm4	A	G	2: 91,928,347	M367V	probably benign	Het
Col1a2	A	T	6: 4,516,904		probably benign	Het
Crybg3	G	A	16: 59,554,165	P2242L	probably damaging	Het
Cspg4	T	C	9: 56,888,074	V1031A	probably damaging	Het
Dbnl	C	A	11: 5,798,102	P313T	probably benign	Het
Dnah1	A	G	14: 31,264,925	F3637L	probably damaging	Het
Dnah7a	A	T	1: 53,479,661	I2979N	probably damaging	Het
Dusp10	T	C	1: 184,037,605	V256A	possibly damaging	Het
Erlin2	T	C	8: 27,031,764	V164A	probably benign	Het
Fam110a	T	C	2: 151,970,211	D213G	probably damaging	Het
Fkbp1a	T	C	2: 151,557,500		probably null	Het
Foxg1	G	A	12: 49,384,720		probably benign	Het
Gm12185	T	C	11: 48,915,999	S122G	probably benign	Het
Gm2042	A	T	12: 87,960,281	D456V	probably damaging	Het
Gm8857	G	T	5: 10,950,551		probably null	Het
Grin2b	A	G	6: 135,923,038	Y282H	probably damaging	Het
Gys2	T	C	6: 142,472,722	D27G	probably benign	Het
H2-DMa	T	A	17: 34,136,997		probably null	Het
Hectd4	T	A	5: 121,364,568	I4245N	possibly damaging	Het
Ints2	C	T	11: 86,233,085	G626R	probably damaging	Het
Kifc1	A	T	17: 33,883,697	V314E	probably damaging	Het
Lurap1l	C	T	4: 80,911,367	P5S	probably benign	Het
Mtmr11	A	G	3: 96,169,946	Y540C	probably damaging	Het
Muc4	C	A	16: 32,756,324		probably benign	Het
Myh13	A	G	11: 67,369,316	E1860G	possibly damaging	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Nbeal1	G	A	1: 60,310,947	G2385D	probably damaging	Het
Ncaph2	G	A	15: 89,371,356	A578T	probably benign	Het
Ncr1	T	C	7: 4,338,145	V8A	possibly damaging	Het
Nutm1	T	C	2: 112,256,168	T73A	probably damaging	Het
Olfm1	G	A	2: 28,229,336	D313N	probably damaging	Het
Olfr1196	T	A	2: 88,700,820	N170Y	probably damaging	Het
Olfr275	A	G	4: 52,826,089	M231V	probably benign	Het
Olfr749	A	G	14: 50,736,707	F152L	possibly damaging	Het
Otog	T	A	7: 46,267,398		probably null	Het
Peak1	G	T	9: 56,259,707	D312E	probably damaging	Het
Plekhg1	T	C	10: 3,940,251	I331T	probably damaging	Het
Polr1b	T	C	2: 129,115,642	V539A	possibly damaging	Het
Polr2a	A	T	11: 69,747,213	H143Q	possibly damaging	Het
Ppargc1b	G	T	18: 61,307,714	A711D	probably damaging	Het
Prnd	T	A	2: 131,953,442	C161S	possibly damaging	Het
Prrt4	A	G	6: 29,171,148	L435P	possibly damaging	Het
Psen2	C	T	1: 180,227,520		probably null	Het
Psg23	T	C	7: 18,614,744	E46G	possibly damaging	Het
Rasgef1b	C	T	5: 99,232,336	R350H	probably damaging	Het
Rfxank	G	C	8: 70,138,170	P16A	probably benign	Het
Sema6a	A	G	18: 47,248,570	I944T	probably damaging	Het
Serpinc1	A	G	1: 160,997,521	T313A	probably benign	Het
Slc27a4	T	C	2: 29,804,271	S36P	possibly damaging	Het
Slc36a1	C	A	11: 55,223,737	R214S	probably benign	Het
Sorl1	C	T	9: 42,030,983	S982N	possibly damaging	Het
Syt1	A	C	10: 108,690,936	D37E	probably benign	Het
Tcl1b5	A	T	12: 105,176,491	D26V	probably damaging	Het
Tenm4	A	T	7: 96,895,223	K2149*	probably null	Het
Ubc	T	A	5: 125,388,174	I30F	probably damaging	Het
Ugt1a7c	A	T	1: 88,095,528	E136D	possibly damaging	Het
Utp20	A	G	10: 88,754,475		probably null	Het
Vmn1r159	C	T	7: 22,842,864	V248I	probably damaging	Het
Vmn2r105	T	C	17: 20,208,612	H734R	probably damaging	Het
Wdr60	T	C	12: 116,211,891	M889V	probably benign	Het
Xrcc2	T	G	5: 25,692,709	I81L	possibly damaging	Het
Zfat	A	C	15: 68,181,015	I310S	probably damaging	Het
Zfp119a	A	G	17: 55,866,009	V278A	probably benign	Het
Zfp53	A	G	17: 21,500,246	K33E	probably benign	Het
Zfp866	G	T	8: 69,765,841	H376Q	probably damaging	Het

Other mutations in Incenp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01324:Incenp	APN	19	9883728	missense	unknown
IGL01717:Incenp	APN	19	9893265	splice site	probably benign
IGL02485:Incenp	APN	19	9893368	missense	unknown
IGL02488:Incenp	APN	19	9893407	missense	unknown
B5639:Incenp	UTSW	19	9893818	missense	unknown
R0060:Incenp	UTSW	19	9885459	splice site	probably benign
R0164:Incenp	UTSW	19	9894879	missense	probably benign	0.23
R0164:Incenp	UTSW	19	9894879	missense	probably benign	0.23
R0242:Incenp	UTSW	19	9893750	missense	unknown
R0242:Incenp	UTSW	19	9893750	missense	unknown
R0284:Incenp	UTSW	19	9893993	missense	unknown
R1264:Incenp	UTSW	19	9884015	missense	unknown
R1432:Incenp	UTSW	19	9885526	missense	unknown
R1679:Incenp	UTSW	19	9895414	missense	unknown
R1827:Incenp	UTSW	19	9872729	missense	possibly damaging	0.94
R1970:Incenp	UTSW	19	9885487	missense	unknown
R3082:Incenp	UTSW	19	9883779	missense	unknown
R3083:Incenp	UTSW	19	9883779	missense	unknown
R4062:Incenp	UTSW	19	9883778	missense	unknown
R4063:Incenp	UTSW	19	9883778	missense	unknown
R4534:Incenp	UTSW	19	9883939	missense	unknown
R4535:Incenp	UTSW	19	9883939	missense	unknown
R4536:Incenp	UTSW	19	9883939	missense	unknown
R4709:Incenp	UTSW	19	9876600	missense	unknown
R4785:Incenp	UTSW	19	9877690	missense	unknown
R4785:Incenp	UTSW	19	9877691	missense	unknown
R5179:Incenp	UTSW	19	9894909	missense	unknown
R5282:Incenp	UTSW	19	9878406	missense	unknown
R5400:Incenp	UTSW	19	9877675	critical splice donor site	probably null
R5502:Incenp	UTSW	19	9893364	missense	unknown
R5608:Incenp	UTSW	19	9893868	small insertion	probably benign
R6033:Incenp	UTSW	19	9872697	missense	probably damaging	0.99
R6033:Incenp	UTSW	19	9872697	missense	probably damaging	0.99
R6807:Incenp	UTSW	19	9877756	missense	unknown
R6885:Incenp	UTSW	19	9875132	missense	unknown
R6959:Incenp	UTSW	19	9876770	missense	unknown
R8258:Incenp	UTSW	19	9893629	missense	unknown
R8258:Incenp	UTSW	19	9893641	missense	unknown
R8259:Incenp	UTSW	19	9893629	missense	unknown
R8259:Incenp	UTSW	19	9893641	missense	unknown
R8293:Incenp	UTSW	19	9875133	nonsense	probably null
R9005:Incenp	UTSW	19	9877724	nonsense	probably null
R9491:Incenp	UTSW	19	9876777	missense	unknown
Z1176:Incenp	UTSW	19	9877687	missense	unknown
Z1177:Incenp	UTSW	19	9899364	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- TCACTGAAATGTCAATGGAAGC -3'
(R):5'- AGGACGTTCTGTTTCCAAGC -3'

Sequencing Primer
(F):5'- GTCAATGGAAGCATCCCAGCTG -3'
(R):5'- TCCAAGCTCAAGATTGCTCGG -3'

Posted On

2019-05-13