Incidental Mutation 'R7033:Incenp'
ID546491
Institutional Source Beutler Lab
Gene Symbol Incenp
Ensembl Gene ENSMUSG00000024660
Gene Nameinner centromere protein
Synonyms2700067E22Rik
MMRRC Submission
Accession Numbers

Genbank: NM_016692

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7033 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location9872297-9899533 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9893372 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 298 (Y298H)
Ref Sequence ENSEMBL: ENSMUSP00000025562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025562]
Predicted Effect unknown
Transcript: ENSMUST00000025562
AA Change: Y298H
SMART Domains Protein: ENSMUSP00000025562
Gene: ENSMUSG00000024660
AA Change: Y298H

DomainStartEndE-ValueType
Pfam:INCENP_N 6 41 1.9e-18 PFAM
low complexity region 83 94 N/A INTRINSIC
low complexity region 123 145 N/A INTRINSIC
low complexity region 308 314 N/A INTRINSIC
low complexity region 350 367 N/A INTRINSIC
low complexity region 434 447 N/A INTRINSIC
low complexity region 517 553 N/A INTRINSIC
low complexity region 557 573 N/A INTRINSIC
SCOP:d1f5na1 631 739 7e-3 SMART
Pfam:INCENP_ARK-bind 789 846 1.5e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In mammalian cells, 2 broad groups of centromere-interacting proteins have been described: constitutively binding centromere proteins and 'passenger,' or transiently interacting, proteins (reviewed by Choo, 1997). The constitutive proteins include CENPA (centromere protein A; MIM 117139), CENPB (MIM 117140), CENPC1 (MIM 117141), and CENPD (MIM 117142). The term 'passenger proteins' encompasses a broad collection of proteins that localize to the centromere during specific stages of the cell cycle (Earnshaw and Mackay, 1994 [PubMed 8088460]). These include CENPE (MIM 117143); MCAK (MIM 604538); KID (MIM 603213); cytoplasmic dynein (e.g., MIM 600112); CliPs (e.g., MIM 179838); and CENPF/mitosin (MIM 600236). The inner centromere proteins (INCENPs) (Earnshaw and Cooke, 1991 [PubMed 1860899]), the initial members of the passenger protein group, display a broad localization along chromosomes in the early stages of mitosis but gradually become concentrated at centromeres as the cell cycle progresses into mid-metaphase. During telophase, the proteins are located within the midbody in the intercellular bridge, where they are discarded after cytokinesis (Cutts et al., 1999 [PubMed 10369859]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant embryos die before E8.5. Embryonic cells exhibit abnormal nuclei and abberent mitosis. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(9)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik A G 14: 41,997,417 Y105C probably damaging Het
2610301B20Rik A G 4: 10,898,014 T199A probably benign Het
Acr T C 15: 89,569,500 S81P probably benign Het
Akr1c14 T C 13: 4,079,178 probably null Het
Ank2 C A 3: 126,944,850 E2375* probably null Het
Avpi1 A G 19: 42,124,977 W14R probably damaging Het
Brd4 A G 17: 32,199,015 V55A probably benign Het
Casp8ap2 A G 4: 32,639,392 N149D probably damaging Het
Ccl25 A T 8: 4,349,641 probably benign Het
Celf5 A G 10: 81,462,714 L299P probably damaging Het
Cfap57 T G 4: 118,613,126 T186P possibly damaging Het
Chrm4 A G 2: 91,928,347 M367V probably benign Het
Col1a2 A T 6: 4,516,904 probably benign Het
Crybg3 G A 16: 59,554,165 P2242L probably damaging Het
Cspg4 T C 9: 56,888,074 V1031A probably damaging Het
Dbnl C A 11: 5,798,102 P313T probably benign Het
Dnah1 A G 14: 31,264,925 F3637L probably damaging Het
Dnah7a A T 1: 53,479,661 I2979N probably damaging Het
Dusp10 T C 1: 184,037,605 V256A possibly damaging Het
Erlin2 T C 8: 27,031,764 V164A probably benign Het
Fam110a T C 2: 151,970,211 D213G probably damaging Het
Fkbp1a T C 2: 151,557,500 probably null Het
Foxg1 G A 12: 49,384,720 probably benign Het
Gm12185 T C 11: 48,915,999 S122G probably benign Het
Gm2042 A T 12: 87,960,281 D456V probably damaging Het
Gm8857 G T 5: 10,950,551 probably null Het
Grin2b A G 6: 135,923,038 Y282H probably damaging Het
Gys2 T C 6: 142,472,722 D27G probably benign Het
H2-DMa T A 17: 34,136,997 probably null Het
Hectd4 T A 5: 121,364,568 I4245N possibly damaging Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Kifc1 A T 17: 33,883,697 V314E probably damaging Het
Lurap1l C T 4: 80,911,367 P5S probably benign Het
Mtmr11 A G 3: 96,169,946 Y540C probably damaging Het
Muc4 C A 16: 32,756,324 probably benign Het
Myh13 A G 11: 67,369,316 E1860G possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nbeal1 G A 1: 60,310,947 G2385D probably damaging Het
Ncaph2 G A 15: 89,371,356 A578T probably benign Het
Ncr1 T C 7: 4,338,145 V8A possibly damaging Het
Nutm1 T C 2: 112,256,168 T73A probably damaging Het
Olfm1 G A 2: 28,229,336 D313N probably damaging Het
Olfr1196 T A 2: 88,700,820 N170Y probably damaging Het
Olfr275 A G 4: 52,826,089 M231V probably benign Het
Olfr749 A G 14: 50,736,707 F152L possibly damaging Het
Otog T A 7: 46,267,398 probably null Het
Peak1 G T 9: 56,259,707 D312E probably damaging Het
Plekhg1 T C 10: 3,940,251 I331T probably damaging Het
Polr1b T C 2: 129,115,642 V539A possibly damaging Het
Polr2a A T 11: 69,747,213 H143Q possibly damaging Het
Ppargc1b G T 18: 61,307,714 A711D probably damaging Het
Prnd T A 2: 131,953,442 C161S possibly damaging Het
Prrt4 A G 6: 29,171,148 L435P possibly damaging Het
Psen2 C T 1: 180,227,520 probably null Het
Psg23 T C 7: 18,614,744 E46G possibly damaging Het
Rasgef1b C T 5: 99,232,336 R350H probably damaging Het
Rfxank G C 8: 70,138,170 P16A probably benign Het
Sema6a A G 18: 47,248,570 I944T probably damaging Het
Serpinc1 A G 1: 160,997,521 T313A probably benign Het
Slc27a4 T C 2: 29,804,271 S36P possibly damaging Het
Slc36a1 C A 11: 55,223,737 R214S probably benign Het
Sorl1 C T 9: 42,030,983 S982N possibly damaging Het
Syt1 A C 10: 108,690,936 D37E probably benign Het
Tcl1b5 A T 12: 105,176,491 D26V probably damaging Het
Tenm4 A T 7: 96,895,223 K2149* probably null Het
Ubc T A 5: 125,388,174 I30F probably damaging Het
Ugt1a7c A T 1: 88,095,528 E136D possibly damaging Het
Utp20 A G 10: 88,754,475 probably null Het
Vmn1r159 C T 7: 22,842,864 V248I probably damaging Het
Vmn2r105 T C 17: 20,208,612 H734R probably damaging Het
Wdr60 T C 12: 116,211,891 M889V probably benign Het
Xrcc2 T G 5: 25,692,709 I81L possibly damaging Het
Zfat A C 15: 68,181,015 I310S probably damaging Het
Zfp119a A G 17: 55,866,009 V278A probably benign Het
Zfp53 A G 17: 21,500,246 K33E probably benign Het
Zfp866 G T 8: 69,765,841 H376Q probably damaging Het
Other mutations in Incenp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Incenp APN 19 9883728 missense unknown
IGL01717:Incenp APN 19 9893265 splice site probably benign
IGL02485:Incenp APN 19 9893368 missense unknown
IGL02488:Incenp APN 19 9893407 missense unknown
B5639:Incenp UTSW 19 9893818 missense unknown
R0060:Incenp UTSW 19 9885459 splice site probably benign
R0164:Incenp UTSW 19 9894879 missense probably benign 0.23
R0164:Incenp UTSW 19 9894879 missense probably benign 0.23
R0242:Incenp UTSW 19 9893750 missense unknown
R0242:Incenp UTSW 19 9893750 missense unknown
R0284:Incenp UTSW 19 9893993 missense unknown
R1264:Incenp UTSW 19 9884015 missense unknown
R1432:Incenp UTSW 19 9885526 missense unknown
R1679:Incenp UTSW 19 9895414 missense unknown
R1827:Incenp UTSW 19 9872729 missense possibly damaging 0.94
R1970:Incenp UTSW 19 9885487 missense unknown
R3082:Incenp UTSW 19 9883779 missense unknown
R3083:Incenp UTSW 19 9883779 missense unknown
R4062:Incenp UTSW 19 9883778 missense unknown
R4063:Incenp UTSW 19 9883778 missense unknown
R4534:Incenp UTSW 19 9883939 missense unknown
R4535:Incenp UTSW 19 9883939 missense unknown
R4536:Incenp UTSW 19 9883939 missense unknown
R4709:Incenp UTSW 19 9876600 missense unknown
R4785:Incenp UTSW 19 9877690 missense unknown
R4785:Incenp UTSW 19 9877691 missense unknown
R5179:Incenp UTSW 19 9894909 missense unknown
R5282:Incenp UTSW 19 9878406 missense unknown
R5400:Incenp UTSW 19 9877675 critical splice donor site probably null
R5502:Incenp UTSW 19 9893364 missense unknown
R5608:Incenp UTSW 19 9893868 small insertion probably benign
R6033:Incenp UTSW 19 9872697 missense probably damaging 0.99
R6033:Incenp UTSW 19 9872697 missense probably damaging 0.99
R6807:Incenp UTSW 19 9877756 missense unknown
R6885:Incenp UTSW 19 9875132 missense unknown
R6959:Incenp UTSW 19 9876770 missense unknown
R8258:Incenp UTSW 19 9893629 missense unknown
R8258:Incenp UTSW 19 9893641 missense unknown
R8259:Incenp UTSW 19 9893629 missense unknown
R8259:Incenp UTSW 19 9893641 missense unknown
R8293:Incenp UTSW 19 9875133 nonsense probably null
Z1176:Incenp UTSW 19 9877687 missense unknown
Z1177:Incenp UTSW 19 9899364 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCACTGAAATGTCAATGGAAGC -3'
(R):5'- AGGACGTTCTGTTTCCAAGC -3'

Sequencing Primer
(F):5'- GTCAATGGAAGCATCCCAGCTG -3'
(R):5'- TCCAAGCTCAAGATTGCTCGG -3'
Posted On2019-05-13