Incidental Mutation 'R0610:Setdb2'
ID 54651
Institutional Source Beutler Lab
Gene Symbol Setdb2
Ensembl Gene ENSMUSG00000071350
Gene Name SET domain, bifurcated 2
Synonyms KMT1F, LOC239122
MMRRC Submission 038799-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.544) question?
Stock # R0610 (G1)
Quality Score 155
Status Validated
Chromosome 14
Chromosomal Location 59639458-59678329 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 59654919 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 324 (S324A)
Ref Sequence ENSEMBL: ENSMUSP00000093450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000161459]
AlphaFold Q8C267
Predicted Effect possibly damaging
Transcript: ENSMUST00000095775
AA Change: S324A

PolyPhen 2 Score 0.549 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350
AA Change: S324A

DomainStartEndE-ValueType
Pfam:MBD 164 236 3.4e-10 PFAM
Pfam:Pre-SET 250 362 1.7e-17 PFAM
SET 370 694 9.33e-32 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000161459
AA Change: S308A

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350
AA Change: S308A

DomainStartEndE-ValueType
Pfam:MBD 148 220 2.7e-9 PFAM
Pfam:Pre-SET 233 346 1.3e-19 PFAM
SET 354 678 9.33e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161959
Meta Mutation Damage Score 0.2008 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,642,480 (GRCm39) T141S probably benign Het
4930578I06Rik G A 14: 64,223,714 (GRCm39) R21* probably null Het
Abca15 A G 7: 119,965,009 (GRCm39) E757G possibly damaging Het
Abca5 T C 11: 110,192,353 (GRCm39) T720A probably benign Het
Actr5 T A 2: 158,474,376 (GRCm39) probably null Het
Adgrl3 T C 5: 81,841,563 (GRCm39) probably benign Het
Adra1a A G 14: 66,875,241 (GRCm39) D72G probably damaging Het
Ahcyl T C 16: 45,974,264 (GRCm39) E371G probably damaging Het
Ahnak G T 19: 8,985,242 (GRCm39) L2175F probably benign Het
AK157302 A G 13: 21,679,833 (GRCm39) T120A possibly damaging Het
Apol7a G A 15: 77,273,454 (GRCm39) A336V probably benign Het
Asic1 C A 15: 99,596,780 (GRCm39) H525Q probably benign Het
Atxn7l2 T C 3: 108,112,090 (GRCm39) D335G possibly damaging Het
Bpgm G T 6: 34,481,284 (GRCm39) R227L possibly damaging Het
Calm4 T A 13: 3,888,320 (GRCm39) V142E possibly damaging Het
Catsperg1 A T 7: 28,890,044 (GRCm39) L721Q probably damaging Het
Cdh26 A G 2: 178,091,691 (GRCm39) I83M probably damaging Het
Cep295 A C 9: 15,234,050 (GRCm39) S2249A possibly damaging Het
Cfhr4 G A 1: 139,629,584 (GRCm39) T799I probably benign Het
Cln3 A G 7: 126,179,361 (GRCm39) F139L probably damaging Het
Cmpk2 T A 12: 26,528,055 (GRCm39) L424Q possibly damaging Het
Col12a1 A T 9: 79,615,130 (GRCm39) V53E probably benign Het
Csmd1 G A 8: 15,968,208 (GRCm39) R3140C possibly damaging Het
Dagla A G 19: 10,248,922 (GRCm39) W11R probably damaging Het
Dbx2 C T 15: 95,522,778 (GRCm39) V310M probably benign Het
Disp2 T A 2: 118,622,717 (GRCm39) C1150S probably benign Het
Dock3 T C 9: 106,900,987 (GRCm39) D326G probably damaging Het
Dph1 G T 11: 75,076,783 (GRCm39) probably benign Het
Dyrk1b C A 7: 27,886,059 (GRCm39) T594K probably damaging Het
Evx2 C A 2: 74,486,331 (GRCm39) A353S probably benign Het
Garin1b T A 6: 29,326,576 (GRCm39) V231E probably benign Het
Greb1 A C 12: 16,746,443 (GRCm39) S1276A probably benign Het
Hhipl1 T A 12: 108,285,661 (GRCm39) C490* probably null Het
Hmmr G T 11: 40,606,729 (GRCm39) T231K probably damaging Het
Hspa4l A C 3: 40,733,832 (GRCm39) E526D probably benign Het
Ibsp A G 5: 104,458,000 (GRCm39) E179G probably benign Het
Ift140 C T 17: 25,254,777 (GRCm39) A150V probably benign Het
Igf2bp2 A G 16: 21,889,059 (GRCm39) S416P probably benign Het
Ighe T C 12: 113,235,363 (GRCm39) K294E unknown Het
Ino80 G A 2: 119,213,441 (GRCm39) R1249C probably damaging Het
Iqca1 C A 1: 90,070,453 (GRCm39) G133V probably null Het
Kng2 T A 16: 22,819,344 (GRCm39) N231Y possibly damaging Het
Lca5 A T 9: 83,281,792 (GRCm39) C331S probably benign Het
Lrrc1 A G 9: 77,379,488 (GRCm39) I101T possibly damaging Het
Lrrk2 A T 15: 91,699,619 (GRCm39) I2489L probably benign Het
Lyz3 A G 10: 117,073,635 (GRCm39) F66S probably benign Het
Mapk9 A C 11: 49,754,400 (GRCm39) N51T probably benign Het
Marf1 C T 16: 13,960,398 (GRCm39) A549T probably damaging Het
Nek2 T A 1: 191,554,627 (GRCm39) V113D probably damaging Het
Nr4a3 C A 4: 48,051,903 (GRCm39) A248E probably benign Het
Nrp1 T C 8: 129,229,099 (GRCm39) I859T probably damaging Het
Olfm5 A T 7: 103,803,652 (GRCm39) Y195* probably null Het
Or13j1 T A 4: 43,706,400 (GRCm39) H56L possibly damaging Het
Or1n2 T A 2: 36,797,671 (GRCm39) W238R probably damaging Het
Or8g35 A G 9: 39,381,119 (GRCm39) L301P probably damaging Het
Oxtr C T 6: 112,454,138 (GRCm39) R42Q probably benign Het
Pcnx2 A G 8: 126,566,426 (GRCm39) W1006R probably damaging Het
Pdpk1 T C 17: 24,317,145 (GRCm39) probably null Het
Ryr2 T A 13: 11,637,838 (GRCm39) H3731L probably damaging Het
Sdr16c5 T G 4: 4,016,116 (GRCm39) E103D possibly damaging Het
Slc17a3 C T 13: 24,039,841 (GRCm39) S293F probably damaging Het
Slc17a8 A T 10: 89,412,488 (GRCm39) I499K probably damaging Het
Slc2a9 T A 5: 38,537,285 (GRCm39) I389F probably damaging Het
Slc30a1 T C 1: 191,641,536 (GRCm39) V394A probably damaging Het
Slc41a2 A G 10: 83,119,592 (GRCm39) I390T possibly damaging Het
Slco1a1 A G 6: 141,864,187 (GRCm39) probably null Het
Slit2 A G 5: 48,433,016 (GRCm39) K1053E possibly damaging Het
Smarca2 T A 19: 26,668,791 (GRCm39) L930Q probably damaging Het
Snx6 T C 12: 54,798,574 (GRCm39) H387R probably damaging Het
Sox5 A T 6: 143,779,165 (GRCm39) M622K possibly damaging Het
Ston1 C A 17: 88,942,709 (GRCm39) N38K possibly damaging Het
Strbp C T 2: 37,474,089 (GRCm39) V658I probably damaging Het
Strn3 T C 12: 51,657,231 (GRCm39) probably null Het
Suco T G 1: 161,687,072 (GRCm39) D96A probably benign Het
Suco A G 1: 161,691,601 (GRCm39) probably benign Het
Sytl2 A T 7: 90,030,061 (GRCm39) probably benign Het
Tmem41b T A 7: 109,580,290 (GRCm39) M25L probably benign Het
Tmem41b T A 7: 109,580,292 (GRCm39) D91V probably damaging Het
Tmem50b C T 16: 91,380,174 (GRCm39) A68T probably damaging Het
Tmprss11e G A 5: 86,855,206 (GRCm39) Q400* probably null Het
Tnfsf13b G A 8: 10,081,661 (GRCm39) probably null Het
Trappc8 A G 18: 20,970,245 (GRCm39) V916A probably damaging Het
Trdn G T 10: 33,350,449 (GRCm39) V673F probably damaging Het
Trim28 G T 7: 12,759,711 (GRCm39) probably benign Het
Txnrd2 T C 16: 18,291,632 (GRCm39) V427A probably damaging Het
Uggt1 T C 1: 36,204,587 (GRCm39) probably benign Het
Vmn1r36 A G 6: 66,693,404 (GRCm39) L51P probably damaging Het
Vmn1r63 T A 7: 5,806,063 (GRCm39) M190L possibly damaging Het
Vmn2r116 T A 17: 23,606,286 (GRCm39) N399K probably damaging Het
Vmn2r117 T C 17: 23,694,488 (GRCm39) N453S probably benign Het
Wbp1l T A 19: 46,643,109 (GRCm39) I370N probably damaging Het
Zfp445 T C 9: 122,682,046 (GRCm39) K632E probably benign Het
Zfp850 C T 7: 27,688,819 (GRCm39) R463H probably damaging Het
Zyg11a A G 4: 108,062,054 (GRCm39) L249P probably damaging Het
Other mutations in Setdb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Setdb2 APN 14 59,653,241 (GRCm39) missense probably damaging 1.00
IGL01695:Setdb2 APN 14 59,639,742 (GRCm39) utr 3 prime probably benign
IGL01720:Setdb2 APN 14 59,660,885 (GRCm39) missense possibly damaging 0.76
IGL02003:Setdb2 APN 14 59,650,939 (GRCm39) missense probably damaging 0.98
IGL02023:Setdb2 APN 14 59,668,607 (GRCm39) missense probably damaging 1.00
IGL02108:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02113:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02114:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02115:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02116:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02117:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02141:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02148:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
R0419:Setdb2 UTSW 14 59,644,193 (GRCm39) splice site probably null
R0636:Setdb2 UTSW 14 59,644,153 (GRCm39) missense probably benign 0.40
R0890:Setdb2 UTSW 14 59,656,669 (GRCm39) missense possibly damaging 0.89
R0931:Setdb2 UTSW 14 59,660,945 (GRCm39) splice site probably benign
R1355:Setdb2 UTSW 14 59,654,890 (GRCm39) missense probably damaging 1.00
R1553:Setdb2 UTSW 14 59,654,934 (GRCm39) missense probably benign 0.04
R1968:Setdb2 UTSW 14 59,656,858 (GRCm39) missense probably damaging 1.00
R2472:Setdb2 UTSW 14 59,656,903 (GRCm39) missense possibly damaging 0.49
R2894:Setdb2 UTSW 14 59,663,916 (GRCm39) missense probably benign 0.00
R3919:Setdb2 UTSW 14 59,656,616 (GRCm39) missense probably damaging 1.00
R4609:Setdb2 UTSW 14 59,653,153 (GRCm39) missense probably damaging 1.00
R4629:Setdb2 UTSW 14 59,646,808 (GRCm39) missense probably benign 0.13
R4816:Setdb2 UTSW 14 59,651,095 (GRCm39) missense probably benign 0.05
R4864:Setdb2 UTSW 14 59,646,715 (GRCm39) missense probably benign 0.01
R4951:Setdb2 UTSW 14 59,639,752 (GRCm39) missense possibly damaging 0.72
R5040:Setdb2 UTSW 14 59,653,156 (GRCm39) missense probably damaging 0.99
R5245:Setdb2 UTSW 14 59,663,943 (GRCm39) missense probably null 0.00
R5358:Setdb2 UTSW 14 59,646,885 (GRCm39) missense probably benign 0.17
R5656:Setdb2 UTSW 14 59,656,567 (GRCm39) missense probably damaging 1.00
R5705:Setdb2 UTSW 14 59,660,814 (GRCm39) missense possibly damaging 0.80
R6103:Setdb2 UTSW 14 59,646,981 (GRCm39) splice site probably null
R6106:Setdb2 UTSW 14 59,660,898 (GRCm39) nonsense probably null
R6388:Setdb2 UTSW 14 59,662,146 (GRCm39) missense probably benign
R6431:Setdb2 UTSW 14 59,656,505 (GRCm39) missense probably damaging 1.00
R6494:Setdb2 UTSW 14 59,639,863 (GRCm39) missense probably benign 0.12
R6971:Setdb2 UTSW 14 59,653,189 (GRCm39) missense probably damaging 1.00
R7442:Setdb2 UTSW 14 59,656,700 (GRCm39) missense probably damaging 0.99
R7444:Setdb2 UTSW 14 59,660,794 (GRCm39) nonsense probably null
R7759:Setdb2 UTSW 14 59,656,813 (GRCm39) missense probably damaging 1.00
R8021:Setdb2 UTSW 14 59,660,833 (GRCm39) nonsense probably null
R8039:Setdb2 UTSW 14 59,639,824 (GRCm39) missense probably damaging 1.00
R8261:Setdb2 UTSW 14 59,651,141 (GRCm39) splice site probably benign
R8393:Setdb2 UTSW 14 59,650,180 (GRCm39) missense probably benign 0.04
R8513:Setdb2 UTSW 14 59,639,839 (GRCm39) missense probably damaging 1.00
R8700:Setdb2 UTSW 14 59,654,888 (GRCm39) missense probably damaging 1.00
R8707:Setdb2 UTSW 14 59,660,907 (GRCm39) nonsense probably null
R8940:Setdb2 UTSW 14 59,646,956 (GRCm39) missense probably damaging 1.00
R9217:Setdb2 UTSW 14 59,646,881 (GRCm39) missense possibly damaging 0.61
R9314:Setdb2 UTSW 14 59,650,240 (GRCm39) missense probably benign 0.02
R9336:Setdb2 UTSW 14 59,660,816 (GRCm39) missense unknown
R9442:Setdb2 UTSW 14 59,639,849 (GRCm39) missense probably damaging 1.00
R9525:Setdb2 UTSW 14 59,646,841 (GRCm39) missense probably benign 0.00
R9743:Setdb2 UTSW 14 59,651,002 (GRCm39) missense probably benign 0.00
X0017:Setdb2 UTSW 14 59,656,917 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGCAGCAGAGTGAATACACTCCAAT -3'
(R):5'- GGCCTACCTTGTTTAGAGAGGTTTCCA -3'

Sequencing Primer
(F):5'- tgaagaaaacaaacaaggtggatag -3'
(R):5'- CCCCACTGCCTTTCTTTTAGAAAA -3'
Posted On 2013-07-11