Incidental Mutation 'R7034:Nwd2'
ID546517
Institutional Source Beutler Lab
Gene Symbol Nwd2
Ensembl Gene ENSMUSG00000090061
Gene NameNACHT and WD repeat domain containing 2
Synonyms3110047P20Rik, B830017A01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R7034 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location63649102-63810546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 63804915 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 614 (N614I)
Ref Sequence ENSEMBL: ENSMUSP00000124712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159584] [ENSMUST00000162166]
Predicted Effect probably damaging
Transcript: ENSMUST00000159584
AA Change: N614I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124712
Gene: ENSMUSG00000090061
AA Change: N614I

DomainStartEndE-ValueType
Pfam:DUF4062 42 145 1.5e-8 PFAM
Blast:AAA 408 691 3e-29 BLAST
WD40 939 995 1.06e2 SMART
WD40 998 1037 8.96e-2 SMART
Blast:WD40 1091 1126 9e-19 BLAST
Blast:WD40 1129 1170 1e-17 BLAST
Blast:WD40 1220 1260 3e-16 BLAST
WD40 1263 1302 3.4e-2 SMART
WD40 1347 1385 2.65e1 SMART
WD40 1386 1425 1.58e2 SMART
Blast:WD40 1466 1507 3e-19 BLAST
Blast:WD40 1606 1644 4e-18 BLAST
Blast:KR 1686 1730 2e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162166
Predicted Effect probably benign
Transcript: ENSMUST00000162757
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,609,256 probably null Het
9030624J02Rik T C 7: 118,773,092 S290P probably damaging Het
9130011E15Rik A G 19: 45,965,249 I195T probably damaging Het
Adamts1 T A 16: 85,802,746 probably benign Het
Aff4 A G 11: 53,408,409 K979E probably damaging Het
Aftph A T 11: 20,692,498 M845K probably damaging Het
Akt2 T C 7: 27,637,012 probably null Het
Aldh1a7 A T 19: 20,708,178 L336Q possibly damaging Het
Ank3 C T 10: 69,999,379 T680M probably damaging Het
Apeh T C 9: 108,094,271 E59G possibly damaging Het
Armc8 C T 9: 99,483,965 probably null Het
Atp2b1 C T 10: 98,987,310 T244I probably damaging Het
Btaf1 C A 19: 37,004,469 T1633K probably benign Het
Cacng8 A G 7: 3,415,303 S324G probably benign Het
Calcr T A 6: 3,692,543 Q400L probably damaging Het
Caprin2 G A 6: 148,848,205 P536S possibly damaging Het
Ccdc54 A T 16: 50,590,588 M105K probably benign Het
Ccna1 T C 3: 55,046,039 E381G possibly damaging Het
Cd2ap A T 17: 42,798,599 L623Q probably damaging Het
Cdkl3 A G 11: 52,027,215 E415G probably benign Het
Chd5 C A 4: 152,360,941 L430I possibly damaging Het
Clspn G A 4: 126,580,982 E975K possibly damaging Het
Cobl C A 11: 12,254,177 V835F probably damaging Het
D430041D05Rik C A 2: 104,192,538 R1037L probably damaging Het
Derl1 A G 15: 57,879,047 probably null Het
Dhrs9 T G 2: 69,393,176 N89K probably benign Het
Erich1 A G 8: 14,064,330 I60T probably benign Het
Fam126b T A 1: 58,535,537 M282L probably benign Het
Fam155a G A 8: 9,770,589 P144S possibly damaging Het
Fam184a A T 10: 53,694,814 S408T possibly damaging Het
Fcgr4 T A 1: 171,020,088 M85K probably benign Het
Foxj3 A G 4: 119,619,300 E259G probably damaging Het
Galnt11 T C 5: 25,258,813 I361T probably damaging Het
Gck A G 11: 5,901,747 S441P probably damaging Het
Gdap1l1 G T 2: 163,446,145 V98F probably damaging Het
Gm13089 A T 4: 143,697,328 I297N probably damaging Het
Gm884 T A 11: 103,615,812 probably benign Het
Gramd1a A G 7: 31,132,756 probably null Het
Herc3 A T 6: 58,876,855 M629L probably benign Het
Hist2h2ab C T 3: 96,219,988 Q25* probably null Het
Hoxc12 G A 15: 102,938,360 G229D probably damaging Het
Itga9 T C 9: 118,698,365 L528P probably benign Het
Krt39 A C 11: 99,521,236 V8G probably benign Het
Krt71 A G 15: 101,738,337 I312T probably benign Het
Mllt11 A G 3: 95,220,433 Y9H probably damaging Het
Mrgpra3 G T 7: 47,590,090 N29K possibly damaging Het
Mug1 A G 6: 121,873,644 T700A probably benign Het
Myl1 T C 1: 66,930,236 N79S probably damaging Het
Myo18b G A 5: 112,723,904 Q2104* probably null Het
Ndufs2 T C 1: 171,238,308 D256G probably benign Het
Nek5 T C 8: 22,107,723 N280S probably benign Het
Olfr794 G A 10: 129,571,072 C139Y possibly damaging Het
Parp1 G T 1: 180,598,252 K849N possibly damaging Het
Pcnx2 T C 8: 125,785,302 T1422A probably damaging Het
Plce1 A G 19: 38,739,357 N1520S probably damaging Het
Ppcdc T C 9: 57,415,170 T149A probably damaging Het
Ppl A G 16: 5,087,502 V1643A probably benign Het
Prrx1 T A 1: 163,248,338 M220L probably benign Het
Pspc1 A C 14: 56,758,628 probably null Het
Ptpn20 A G 14: 33,614,435 *44W probably null Het
Qars T A 9: 108,514,777 V83E probably damaging Het
Rbm33 T C 5: 28,394,498 M956T unknown Het
Sash1 C A 10: 8,730,083 E848* probably null Het
Scai T A 2: 39,121,135 Y163F probably damaging Het
Serpinf2 A T 11: 75,438,418 probably benign Het
Sgo2b T A 8: 63,926,834 H988L probably benign Het
Sh2b2 G A 5: 136,218,885 T604I probably benign Het
Skint4 A T 4: 112,158,084 I449F possibly damaging Het
Slc30a2 A G 4: 134,347,342 I88V possibly damaging Het
Smug1 A G 15: 103,155,942 L184P probably damaging Het
Spatc1 A G 15: 76,283,880 T180A probably benign Het
Ssr1 A T 13: 37,994,025 L20Q probably null Het
Supt4a A G 11: 87,743,258 E100G probably damaging Het
Teddm2 T C 1: 153,850,574 I132V probably benign Het
Tmem131 C T 1: 36,792,973 G1861E possibly damaging Het
Tpr A T 1: 150,423,607 H1186L probably benign Het
Trim34b A T 7: 104,329,536 probably benign Het
Trpm2 T C 10: 77,912,592 M1415V probably benign Het
Ttll12 A G 15: 83,586,885 F264S probably benign Het
Vmn2r59 T C 7: 42,046,220 E256G probably benign Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Wdfy3 G A 5: 101,907,518 T1562I probably damaging Het
Ybey T C 10: 76,468,363 S2G possibly damaging Het
Zfp346 A T 13: 55,132,387 Q308L probably benign Het
Other mutations in Nwd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Nwd2 APN 5 63805475 missense probably benign
IGL01111:Nwd2 APN 5 63807300 missense probably damaging 1.00
IGL01152:Nwd2 APN 5 63806529 missense possibly damaging 0.74
IGL01307:Nwd2 APN 5 63808283 missense possibly damaging 0.95
IGL01449:Nwd2 APN 5 63805594 missense probably damaging 1.00
IGL01624:Nwd2 APN 5 63806810 missense probably damaging 1.00
IGL01997:Nwd2 APN 5 63804595 missense probably damaging 0.99
IGL02007:Nwd2 APN 5 63804699 missense possibly damaging 0.87
IGL02143:Nwd2 APN 5 63791653 splice site probably null
IGL02184:Nwd2 APN 5 63805677 missense probably damaging 1.00
IGL02379:Nwd2 APN 5 63805301 missense probably damaging 1.00
IGL02489:Nwd2 APN 5 63805227 missense probably damaging 1.00
IGL02580:Nwd2 APN 5 63808169 missense probably damaging 0.99
IGL02682:Nwd2 APN 5 63804677 missense probably benign 0.03
IGL02682:Nwd2 APN 5 63804678 missense probably damaging 1.00
IGL02891:Nwd2 APN 5 63725227 missense possibly damaging 0.91
IGL03135:Nwd2 APN 5 63805995 missense probably damaging 1.00
IGL03149:Nwd2 APN 5 63805995 missense probably damaging 1.00
R0113:Nwd2 UTSW 5 63807898 missense probably damaging 1.00
R0172:Nwd2 UTSW 5 63806369 missense probably benign 0.44
R0196:Nwd2 UTSW 5 63806351 missense probably benign 0.37
R0239:Nwd2 UTSW 5 63800124 missense probably benign 0.01
R0239:Nwd2 UTSW 5 63800124 missense probably benign 0.01
R0309:Nwd2 UTSW 5 63807218 missense probably damaging 1.00
R0311:Nwd2 UTSW 5 63804998 missense probably damaging 0.99
R0335:Nwd2 UTSW 5 63804773 missense probably benign 0.00
R0384:Nwd2 UTSW 5 63805682 missense probably benign 0.11
R0496:Nwd2 UTSW 5 63806343 missense probably damaging 0.99
R0497:Nwd2 UTSW 5 63806343 missense probably damaging 0.99
R0498:Nwd2 UTSW 5 63806343 missense probably damaging 0.99
R0505:Nwd2 UTSW 5 63805111 missense probably damaging 1.00
R0655:Nwd2 UTSW 5 63791585 missense possibly damaging 0.73
R0762:Nwd2 UTSW 5 63800414 missense probably benign 0.33
R0835:Nwd2 UTSW 5 63800130 missense probably damaging 0.99
R0926:Nwd2 UTSW 5 63807891 missense probably damaging 0.99
R0948:Nwd2 UTSW 5 63807312 missense probably damaging 1.00
R1015:Nwd2 UTSW 5 63806811 missense probably damaging 1.00
R1086:Nwd2 UTSW 5 63806574 missense probably damaging 1.00
R1186:Nwd2 UTSW 5 63650024 utr 5 prime probably benign
R1305:Nwd2 UTSW 5 63745197 missense probably damaging 0.97
R1542:Nwd2 UTSW 5 63806975 missense probably damaging 1.00
R1548:Nwd2 UTSW 5 63800182 missense probably benign 0.00
R1553:Nwd2 UTSW 5 63800505 missense probably benign 0.00
R1636:Nwd2 UTSW 5 63807557 missense probably damaging 1.00
R1658:Nwd2 UTSW 5 63807246 missense probably damaging 1.00
R1763:Nwd2 UTSW 5 63808271 missense probably benign
R1800:Nwd2 UTSW 5 63805574 missense probably benign 0.15
R1813:Nwd2 UTSW 5 63805410 missense probably benign 0.00
R1861:Nwd2 UTSW 5 63804854 missense probably damaging 0.96
R1889:Nwd2 UTSW 5 63807666 missense possibly damaging 0.49
R1896:Nwd2 UTSW 5 63805410 missense probably benign 0.00
R1919:Nwd2 UTSW 5 63806180 missense probably damaging 1.00
R1922:Nwd2 UTSW 5 63794242 missense probably benign
R2258:Nwd2 UTSW 5 63805156 missense probably benign 0.00
R2292:Nwd2 UTSW 5 63805574 missense probably benign 0.15
R2504:Nwd2 UTSW 5 63804374 missense probably benign 0.02
R2869:Nwd2 UTSW 5 63800328 missense probably benign 0.00
R2869:Nwd2 UTSW 5 63800328 missense probably benign 0.00
R2958:Nwd2 UTSW 5 63805982 missense probably benign 0.01
R3034:Nwd2 UTSW 5 63800103 missense probably damaging 1.00
R3422:Nwd2 UTSW 5 63725193 missense possibly damaging 0.46
R3423:Nwd2 UTSW 5 63800161 missense probably damaging 1.00
R3439:Nwd2 UTSW 5 63804552 missense probably benign 0.00
R4193:Nwd2 UTSW 5 63807465 missense probably damaging 1.00
R4254:Nwd2 UTSW 5 63806546 missense possibly damaging 0.74
R4384:Nwd2 UTSW 5 63806571 missense probably damaging 1.00
R4707:Nwd2 UTSW 5 63794322 missense probably damaging 1.00
R4713:Nwd2 UTSW 5 63804460 missense probably benign 0.00
R4735:Nwd2 UTSW 5 63808251 missense probably benign 0.34
R4744:Nwd2 UTSW 5 63806967 missense probably damaging 1.00
R4795:Nwd2 UTSW 5 63805433 missense probably benign 0.21
R4835:Nwd2 UTSW 5 63807846 missense probably benign 0.00
R4839:Nwd2 UTSW 5 63805550 missense possibly damaging 0.92
R4896:Nwd2 UTSW 5 63804808 missense probably damaging 1.00
R5017:Nwd2 UTSW 5 63650141 utr 5 prime probably benign
R5170:Nwd2 UTSW 5 63806037 missense probably damaging 0.99
R5312:Nwd2 UTSW 5 63806072 nonsense probably null
R5330:Nwd2 UTSW 5 63806516 missense probably benign 0.02
R5331:Nwd2 UTSW 5 63806516 missense probably benign 0.02
R5419:Nwd2 UTSW 5 63807708 missense probably benign 0.11
R5434:Nwd2 UTSW 5 63807648 missense probably benign 0.00
R5445:Nwd2 UTSW 5 63805338 missense probably damaging 1.00
R5761:Nwd2 UTSW 5 63725230 missense probably damaging 1.00
R5788:Nwd2 UTSW 5 63807771 missense probably benign 0.00
R5907:Nwd2 UTSW 5 63805983 missense probably damaging 0.99
R5959:Nwd2 UTSW 5 63808070 missense probably benign 0.32
R6002:Nwd2 UTSW 5 63804800 missense probably benign
R6027:Nwd2 UTSW 5 63808220 missense possibly damaging 0.65
R6082:Nwd2 UTSW 5 63805031 missense possibly damaging 0.96
R6163:Nwd2 UTSW 5 63805788 missense probably benign 0.00
R6172:Nwd2 UTSW 5 63806906 missense probably damaging 0.98
R6334:Nwd2 UTSW 5 63800253 missense possibly damaging 0.95
R6447:Nwd2 UTSW 5 63807555 missense probably benign 0.41
R6649:Nwd2 UTSW 5 63725184 missense possibly damaging 0.89
R6855:Nwd2 UTSW 5 63804451 missense probably benign 0.00
R7168:Nwd2 UTSW 5 63807494 missense probably benign 0.04
R7326:Nwd2 UTSW 5 63800409 missense probably damaging 1.00
R7561:Nwd2 UTSW 5 63807091 nonsense probably null
R7576:Nwd2 UTSW 5 63807393 missense probably benign 0.00
R7580:Nwd2 UTSW 5 63808281 missense probably benign 0.05
R7723:Nwd2 UTSW 5 63808004 missense possibly damaging 0.69
R7769:Nwd2 UTSW 5 63804504 missense probably damaging 0.99
RF020:Nwd2 UTSW 5 63805723 nonsense probably null
X0023:Nwd2 UTSW 5 63806963 missense probably damaging 0.99
Z1176:Nwd2 UTSW 5 63725197 missense probably damaging 1.00
Z1176:Nwd2 UTSW 5 63806157 missense probably damaging 1.00
Z1177:Nwd2 UTSW 5 63804984 missense possibly damaging 0.60
Z1177:Nwd2 UTSW 5 63807326 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCGGTGCCTTATCCATGAAG -3'
(R):5'- TTCATAACGCTGTTGTCCAGAG -3'

Sequencing Primer
(F):5'- CGGTGCCTTATCCATGAAGAAGAC -3'
(R):5'- ACGCTGTTGTCCAGAGCTAATAC -3'
Posted On2019-05-13