Incidental Mutation 'R7034:Mug1'
ID546523
Institutional Source Beutler Lab
Gene Symbol Mug1
Ensembl Gene ENSMUSG00000059908
Gene Namemurinoglobulin 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7034 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location121838541-121889057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121873644 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 700 (T700A)
Ref Sequence ENSEMBL: ENSMUSP00000032228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032228]
Predicted Effect probably benign
Transcript: ENSMUST00000032228
AA Change: T700A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000032228
Gene: ENSMUSG00000059908
AA Change: T700A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:A2M_N 128 221 5e-21 PFAM
A2M_N_2 449 599 2.55e-41 SMART
A2M 740 830 5.43e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
Pfam:A2M_comp 1012 1268 5.4e-94 PFAM
A2M_recep 1378 1465 4.14e-41 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and phenotypically normal under standard conditions but show increased mortality in response to diet-induced acute pancreatitis along with hepatic cell necrosis and inflammatory infiltration, andincreased plasma amylase and lipase levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,609,256 probably null Het
9030624J02Rik T C 7: 118,773,092 S290P probably damaging Het
9130011E15Rik A G 19: 45,965,249 I195T probably damaging Het
Adamts1 T A 16: 85,802,746 probably benign Het
Aff4 A G 11: 53,408,409 K979E probably damaging Het
Aftph A T 11: 20,692,498 M845K probably damaging Het
Akt2 T C 7: 27,637,012 probably null Het
Aldh1a7 A T 19: 20,708,178 L336Q possibly damaging Het
Ank3 C T 10: 69,999,379 T680M probably damaging Het
Apeh T C 9: 108,094,271 E59G possibly damaging Het
Armc8 C T 9: 99,483,965 probably null Het
Atp2b1 C T 10: 98,987,310 T244I probably damaging Het
Btaf1 C A 19: 37,004,469 T1633K probably benign Het
Cacng8 A G 7: 3,415,303 S324G probably benign Het
Calcr T A 6: 3,692,543 Q400L probably damaging Het
Caprin2 G A 6: 148,848,205 P536S possibly damaging Het
Ccdc54 A T 16: 50,590,588 M105K probably benign Het
Ccna1 T C 3: 55,046,039 E381G possibly damaging Het
Cd2ap A T 17: 42,798,599 L623Q probably damaging Het
Cdkl3 A G 11: 52,027,215 E415G probably benign Het
Chd5 C A 4: 152,360,941 L430I possibly damaging Het
Clspn G A 4: 126,580,982 E975K possibly damaging Het
Cobl C A 11: 12,254,177 V835F probably damaging Het
D430041D05Rik C A 2: 104,192,538 R1037L probably damaging Het
Derl1 A G 15: 57,879,047 probably null Het
Dhrs9 T G 2: 69,393,176 N89K probably benign Het
Erich1 A G 8: 14,064,330 I60T probably benign Het
Fam126b T A 1: 58,535,537 M282L probably benign Het
Fam155a G A 8: 9,770,589 P144S possibly damaging Het
Fam184a A T 10: 53,694,814 S408T possibly damaging Het
Fcgr4 T A 1: 171,020,088 M85K probably benign Het
Foxj3 A G 4: 119,619,300 E259G probably damaging Het
Galnt11 T C 5: 25,258,813 I361T probably damaging Het
Gck A G 11: 5,901,747 S441P probably damaging Het
Gdap1l1 G T 2: 163,446,145 V98F probably damaging Het
Gm13089 A T 4: 143,697,328 I297N probably damaging Het
Gm884 T A 11: 103,615,812 probably benign Het
Gramd1a A G 7: 31,132,756 probably null Het
Herc3 A T 6: 58,876,855 M629L probably benign Het
Hist2h2ab C T 3: 96,219,988 Q25* probably null Het
Hoxc12 G A 15: 102,938,360 G229D probably damaging Het
Itga9 T C 9: 118,698,365 L528P probably benign Het
Krt39 A C 11: 99,521,236 V8G probably benign Het
Krt71 A G 15: 101,738,337 I312T probably benign Het
Mllt11 A G 3: 95,220,433 Y9H probably damaging Het
Mrgpra3 G T 7: 47,590,090 N29K possibly damaging Het
Myl1 T C 1: 66,930,236 N79S probably damaging Het
Myo18b G A 5: 112,723,904 Q2104* probably null Het
Ndufs2 T C 1: 171,238,308 D256G probably benign Het
Nek5 T C 8: 22,107,723 N280S probably benign Het
Nwd2 A T 5: 63,804,915 N614I probably damaging Het
Olfr794 G A 10: 129,571,072 C139Y possibly damaging Het
Parp1 G T 1: 180,598,252 K849N possibly damaging Het
Pcnx2 T C 8: 125,785,302 T1422A probably damaging Het
Plce1 A G 19: 38,739,357 N1520S probably damaging Het
Ppcdc T C 9: 57,415,170 T149A probably damaging Het
Ppl A G 16: 5,087,502 V1643A probably benign Het
Prrx1 T A 1: 163,248,338 M220L probably benign Het
Pspc1 A C 14: 56,758,628 probably null Het
Ptpn20 A G 14: 33,614,435 *44W probably null Het
Qars T A 9: 108,514,777 V83E probably damaging Het
Rbm33 T C 5: 28,394,498 M956T unknown Het
Sash1 C A 10: 8,730,083 E848* probably null Het
Scai T A 2: 39,121,135 Y163F probably damaging Het
Serpinf2 A T 11: 75,438,418 probably benign Het
Sgo2b T A 8: 63,926,834 H988L probably benign Het
Sh2b2 G A 5: 136,218,885 T604I probably benign Het
Skint4 A T 4: 112,158,084 I449F possibly damaging Het
Slc30a2 A G 4: 134,347,342 I88V possibly damaging Het
Smug1 A G 15: 103,155,942 L184P probably damaging Het
Spatc1 A G 15: 76,283,880 T180A probably benign Het
Ssr1 A T 13: 37,994,025 L20Q probably null Het
Supt4a A G 11: 87,743,258 E100G probably damaging Het
Teddm2 T C 1: 153,850,574 I132V probably benign Het
Tmem131 C T 1: 36,792,973 G1861E possibly damaging Het
Tpr A T 1: 150,423,607 H1186L probably benign Het
Trim34b A T 7: 104,329,536 probably benign Het
Trpm2 T C 10: 77,912,592 M1415V probably benign Het
Ttll12 A G 15: 83,586,885 F264S probably benign Het
Vmn2r59 T C 7: 42,046,220 E256G probably benign Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Wdfy3 G A 5: 101,907,518 T1562I probably damaging Het
Ybey T C 10: 76,468,363 S2G possibly damaging Het
Zfp346 A T 13: 55,132,387 Q308L probably benign Het
Other mutations in Mug1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Mug1 APN 6 121865809 missense probably damaging 1.00
IGL00485:Mug1 APN 6 121887416 missense probably benign 0.17
IGL00816:Mug1 APN 6 121882638 missense probably damaging 0.99
IGL01140:Mug1 APN 6 121882734 missense probably benign 0.01
IGL01141:Mug1 APN 6 121870499 missense probably benign 0.08
IGL01384:Mug1 APN 6 121849474 splice site probably benign
IGL01659:Mug1 APN 6 121870660 splice site probably benign
IGL02049:Mug1 APN 6 121871336 missense probably benign
IGL02151:Mug1 APN 6 121884690 critical splice donor site probably null
IGL02315:Mug1 APN 6 121840167 missense probably benign
IGL02629:Mug1 APN 6 121840065 missense possibly damaging 0.62
IGL02642:Mug1 APN 6 121882585 missense probably benign 0.14
IGL02807:Mug1 APN 6 121886572 missense probably damaging 0.96
IGL02932:Mug1 APN 6 121887427 missense probably benign 0.35
IGL03232:Mug1 APN 6 121878535 missense probably benign 0.00
R1462_Mug1_304 UTSW 6 121882629 missense probably benign 0.41
R2341_Mug1_749 UTSW 6 121884629 missense probably benign 0.06
R4261_Mug1_652 UTSW 6 121873734 missense probably benign
R6173_mug1_139 UTSW 6 121863793 missense probably damaging 0.99
IGL03050:Mug1 UTSW 6 121880571 missense possibly damaging 0.90
R0101:Mug1 UTSW 6 121884247 missense possibly damaging 0.59
R0194:Mug1 UTSW 6 121840107 missense probably damaging 0.98
R0196:Mug1 UTSW 6 121838725 critical splice donor site probably null
R0325:Mug1 UTSW 6 121849842 missense probably benign
R0332:Mug1 UTSW 6 121849897 splice site probably null
R0377:Mug1 UTSW 6 121857361 missense probably benign 0.02
R0393:Mug1 UTSW 6 121849850 missense possibly damaging 0.64
R0414:Mug1 UTSW 6 121856554 missense probably benign 0.00
R0457:Mug1 UTSW 6 121861555 missense probably benign 0.06
R0479:Mug1 UTSW 6 121840227 missense probably benign
R0519:Mug1 UTSW 6 121851424 missense possibly damaging 0.83
R0535:Mug1 UTSW 6 121851454 missense probably benign
R0745:Mug1 UTSW 6 121887427 missense probably benign 0.35
R0939:Mug1 UTSW 6 121884349 missense possibly damaging 0.95
R0975:Mug1 UTSW 6 121878539 missense probably damaging 0.99
R1033:Mug1 UTSW 6 121880551 missense probably damaging 0.99
R1086:Mug1 UTSW 6 121885854 missense probably damaging 1.00
R1116:Mug1 UTSW 6 121870645 missense probably benign
R1131:Mug1 UTSW 6 121861185 missense probably benign 0.18
R1249:Mug1 UTSW 6 121849461 missense probably benign 0.07
R1364:Mug1 UTSW 6 121881713 missense probably damaging 1.00
R1418:Mug1 UTSW 6 121838676 missense probably benign 0.00
R1462:Mug1 UTSW 6 121882629 missense probably benign 0.41
R1462:Mug1 UTSW 6 121882629 missense probably benign 0.41
R1494:Mug1 UTSW 6 121879300 missense probably damaging 1.00
R1639:Mug1 UTSW 6 121880571 missense probably damaging 1.00
R1901:Mug1 UTSW 6 121881821 missense probably benign
R1902:Mug1 UTSW 6 121881821 missense probably benign
R2087:Mug1 UTSW 6 121856291 missense probably benign 0.00
R2168:Mug1 UTSW 6 121870499 missense probably benign 0.08
R2249:Mug1 UTSW 6 121870510 missense probably benign
R2341:Mug1 UTSW 6 121884629 missense probably benign 0.06
R2888:Mug1 UTSW 6 121881843 missense probably benign 0.44
R2892:Mug1 UTSW 6 121840070 missense possibly damaging 0.91
R3703:Mug1 UTSW 6 121888556 splice site probably benign
R3789:Mug1 UTSW 6 121884628 missense probably benign 0.03
R3790:Mug1 UTSW 6 121884628 missense probably benign 0.03
R3950:Mug1 UTSW 6 121878530 missense probably damaging 1.00
R4261:Mug1 UTSW 6 121873734 missense probably benign
R4402:Mug1 UTSW 6 121879352 missense probably damaging 1.00
R4589:Mug1 UTSW 6 121857351 missense probably benign 0.19
R4707:Mug1 UTSW 6 121884641 missense probably damaging 1.00
R4766:Mug1 UTSW 6 121884254 missense probably benign 0.01
R4840:Mug1 UTSW 6 121885854 missense probably damaging 1.00
R4984:Mug1 UTSW 6 121838617 utr 5 prime probably benign
R4999:Mug1 UTSW 6 121878943 nonsense probably null
R5198:Mug1 UTSW 6 121874562 missense probably damaging 1.00
R5220:Mug1 UTSW 6 121861133 missense probably benign 0.03
R5253:Mug1 UTSW 6 121888913 missense probably benign 0.03
R5273:Mug1 UTSW 6 121873789 missense probably damaging 0.99
R5285:Mug1 UTSW 6 121841107 missense probably benign 0.45
R5387:Mug1 UTSW 6 121884394 missense probably damaging 0.99
R5560:Mug1 UTSW 6 121861073 missense probably damaging 0.96
R5652:Mug1 UTSW 6 121840181 missense probably benign
R5704:Mug1 UTSW 6 121851433 missense possibly damaging 0.63
R5732:Mug1 UTSW 6 121878493 missense probably benign 0.00
R6053:Mug1 UTSW 6 121865738 missense probably benign 0.00
R6173:Mug1 UTSW 6 121863793 missense probably damaging 0.99
R6578:Mug1 UTSW 6 121887452 missense probably benign 0.00
R6647:Mug1 UTSW 6 121840241 missense probably benign 0.02
R6681:Mug1 UTSW 6 121838724 missense possibly damaging 0.75
R6925:Mug1 UTSW 6 121881787 missense probably damaging 1.00
R7014:Mug1 UTSW 6 121861125 missense probably benign 0.22
R7031:Mug1 UTSW 6 121838714 missense probably benign 0.00
R7156:Mug1 UTSW 6 121880905 missense probably damaging 1.00
R7156:Mug1 UTSW 6 121884343 missense probably damaging 1.00
R7179:Mug1 UTSW 6 121857420 missense probably benign 0.00
R7211:Mug1 UTSW 6 121880539 missense possibly damaging 0.52
R7318:Mug1 UTSW 6 121870652 critical splice donor site probably null
R7462:Mug1 UTSW 6 121875440 missense probably benign 0.00
R7479:Mug1 UTSW 6 121878508 missense possibly damaging 0.83
R7588:Mug1 UTSW 6 121875517 missense probably damaging 1.00
R7611:Mug1 UTSW 6 121875428 critical splice acceptor site probably null
R7659:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7660:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7661:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7663:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7664:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7666:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7788:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7789:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7794:Mug1 UTSW 6 121856288 missense possibly damaging 0.93
R7809:Mug1 UTSW 6 121878985 missense possibly damaging 0.79
R7836:Mug1 UTSW 6 121870652 critical splice donor site probably null
R7867:Mug1 UTSW 6 121873634 missense probably benign
R7904:Mug1 UTSW 6 121851465 missense probably benign
R7937:Mug1 UTSW 6 121861169 missense probably benign 0.00
R7981:Mug1 UTSW 6 121881764 missense probably damaging 1.00
R7999:Mug1 UTSW 6 121880896 missense possibly damaging 0.90
R8070:Mug1 UTSW 6 121875879 missense probably benign 0.26
R8071:Mug1 UTSW 6 121873672 missense probably benign
R8151:Mug1 UTSW 6 121841158 missense probably benign 0.01
R8491:Mug1 UTSW 6 121882729 missense probably damaging 1.00
R8714:Mug1 UTSW 6 121882722 missense probably benign 0.01
R8734:Mug1 UTSW 6 121871381 missense probably benign 0.00
R8807:Mug1 UTSW 6 121874475 missense probably benign 0.27
R8931:Mug1 UTSW 6 121884337 missense probably benign
R8940:Mug1 UTSW 6 121881683 missense
RF017:Mug1 UTSW 6 121884574 missense probably damaging 1.00
X0064:Mug1 UTSW 6 121861215 missense possibly damaging 0.48
Z1176:Mug1 UTSW 6 121841294 missense probably benign 0.32
Z1176:Mug1 UTSW 6 121880493 missense probably damaging 1.00
Z1177:Mug1 UTSW 6 121863808 missense probably damaging 0.99
Z1177:Mug1 UTSW 6 121879299 critical splice acceptor site probably null
Z1177:Mug1 UTSW 6 121886568 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACAGTCTCCTCCAAAATGAGTG -3'
(R):5'- TCCATGTAAGACTGCTTCACC -3'

Sequencing Primer
(F):5'- CTCCTCCAAAATGAGTGATTCAATGC -3'
(R):5'- ACCTACTACTCAATATGGTGATCCTG -3'
Posted On2019-05-13