Incidental Mutation 'R7034:Mug1'
ID 546523
Institutional Source Beutler Lab
Gene Symbol Mug1
Ensembl Gene ENSMUSG00000059908
Gene Name murinoglobulin 1
Synonyms
MMRRC Submission 045135-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7034 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 121815500-121866016 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121850603 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 700 (T700A)
Ref Sequence ENSEMBL: ENSMUSP00000032228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032228]
AlphaFold P28665
Predicted Effect probably benign
Transcript: ENSMUST00000032228
AA Change: T700A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000032228
Gene: ENSMUSG00000059908
AA Change: T700A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:A2M_N 128 221 5e-21 PFAM
A2M_N_2 449 599 2.55e-41 SMART
A2M 740 830 5.43e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
Pfam:A2M_comp 1012 1268 5.4e-94 PFAM
A2M_recep 1378 1465 4.14e-41 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and phenotypically normal under standard conditions but show increased mortality in response to diet-induced acute pancreatitis along with hepatic cell necrosis and inflammatory infiltration, andincreased plasma amylase and lipase levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,445,118 (GRCm39) probably null Het
Adamts1 T A 16: 85,599,634 (GRCm39) probably benign Het
Aff4 A G 11: 53,299,236 (GRCm39) K979E probably damaging Het
Aftph A T 11: 20,642,498 (GRCm39) M845K probably damaging Het
Akt2 T C 7: 27,336,437 (GRCm39) probably null Het
Aldh1a7 A T 19: 20,685,542 (GRCm39) L336Q possibly damaging Het
Ank3 C T 10: 69,835,209 (GRCm39) T680M probably damaging Het
Apeh T C 9: 107,971,470 (GRCm39) E59G possibly damaging Het
Armc8 C T 9: 99,366,018 (GRCm39) probably null Het
Armh3 A G 19: 45,953,688 (GRCm39) I195T probably damaging Het
Atp2b1 C T 10: 98,823,172 (GRCm39) T244I probably damaging Het
Btaf1 C A 19: 36,981,869 (GRCm39) T1633K probably benign Het
Cacng8 A G 7: 3,463,819 (GRCm39) S324G probably benign Het
Calcr T A 6: 3,692,543 (GRCm39) Q400L probably damaging Het
Caprin2 G A 6: 148,749,703 (GRCm39) P536S possibly damaging Het
Ccdc54 A T 16: 50,410,951 (GRCm39) M105K probably benign Het
Ccna1 T C 3: 54,953,460 (GRCm39) E381G possibly damaging Het
Cd2ap A T 17: 43,109,490 (GRCm39) L623Q probably damaging Het
Cdkl3 A G 11: 51,918,042 (GRCm39) E415G probably benign Het
Chd5 C A 4: 152,445,398 (GRCm39) L430I possibly damaging Het
Clspn G A 4: 126,474,775 (GRCm39) E975K possibly damaging Het
Cobl C A 11: 12,204,177 (GRCm39) V835F probably damaging Het
D430041D05Rik C A 2: 104,022,883 (GRCm39) R1037L probably damaging Het
Derl1 A G 15: 57,742,443 (GRCm39) probably null Het
Dhrs9 T G 2: 69,223,520 (GRCm39) N89K probably benign Het
Erich1 A G 8: 14,114,330 (GRCm39) I60T probably benign Het
Fam184a A T 10: 53,570,910 (GRCm39) S408T possibly damaging Het
Fcgr4 T A 1: 170,847,657 (GRCm39) M85K probably benign Het
Foxj3 A G 4: 119,476,497 (GRCm39) E259G probably damaging Het
Galnt11 T C 5: 25,463,811 (GRCm39) I361T probably damaging Het
Gck A G 11: 5,851,747 (GRCm39) S441P probably damaging Het
Gdap1l1 G T 2: 163,288,065 (GRCm39) V98F probably damaging Het
Gramd1a A G 7: 30,832,181 (GRCm39) probably null Het
H2ac21 C T 3: 96,127,304 (GRCm39) Q25* probably null Het
Herc3 A T 6: 58,853,840 (GRCm39) M629L probably benign Het
Hoxc12 G A 15: 102,846,795 (GRCm39) G229D probably damaging Het
Hycc2 T A 1: 58,574,696 (GRCm39) M282L probably benign Het
Itga9 T C 9: 118,527,433 (GRCm39) L528P probably benign Het
Krt39 A C 11: 99,412,062 (GRCm39) V8G probably benign Het
Krt71 A G 15: 101,646,772 (GRCm39) I312T probably benign Het
Lrrc37 T A 11: 103,506,638 (GRCm39) probably benign Het
Mllt11 A G 3: 95,127,744 (GRCm39) Y9H probably damaging Het
Mrgpra3 G T 7: 47,239,838 (GRCm39) N29K possibly damaging Het
Myl1 T C 1: 66,969,395 (GRCm39) N79S probably damaging Het
Myo18b G A 5: 112,871,770 (GRCm39) Q2104* probably null Het
Nalf1 G A 8: 9,820,589 (GRCm39) P144S possibly damaging Het
Ndufs2 T C 1: 171,065,877 (GRCm39) D256G probably benign Het
Nek5 T C 8: 22,597,739 (GRCm39) N280S probably benign Het
Nwd2 A T 5: 63,962,258 (GRCm39) N614I probably damaging Het
Or6c88 G A 10: 129,406,941 (GRCm39) C139Y possibly damaging Het
Parp1 G T 1: 180,425,817 (GRCm39) K849N possibly damaging Het
Pcnx2 T C 8: 126,512,041 (GRCm39) T1422A probably damaging Het
Plce1 A G 19: 38,727,801 (GRCm39) N1520S probably damaging Het
Ppcdc T C 9: 57,322,453 (GRCm39) T149A probably damaging Het
Ppl A G 16: 4,905,366 (GRCm39) V1643A probably benign Het
Pramel23 A T 4: 143,423,898 (GRCm39) I297N probably damaging Het
Prrx1 T A 1: 163,075,907 (GRCm39) M220L probably benign Het
Pspc1 A C 14: 56,996,085 (GRCm39) probably null Het
Ptpn20 A G 14: 33,336,392 (GRCm39) *44W probably null Het
Qars1 T A 9: 108,391,976 (GRCm39) V83E probably damaging Het
Rbm33 T C 5: 28,599,496 (GRCm39) M956T unknown Het
Sash1 C A 10: 8,605,847 (GRCm39) E848* probably null Het
Scai T A 2: 39,011,147 (GRCm39) Y163F probably damaging Het
Serpinf2 A T 11: 75,329,244 (GRCm39) probably benign Het
Sgo2b T A 8: 64,379,868 (GRCm39) H988L probably benign Het
Sh2b2 G A 5: 136,247,739 (GRCm39) T604I probably benign Het
Skint4 A T 4: 112,015,281 (GRCm39) I449F possibly damaging Het
Slc30a2 A G 4: 134,074,653 (GRCm39) I88V possibly damaging Het
Smug1 A G 15: 103,064,369 (GRCm39) L184P probably damaging Het
Spatc1 A G 15: 76,168,080 (GRCm39) T180A probably benign Het
Ssr1 A T 13: 38,178,001 (GRCm39) L20Q probably null Het
Supt4a A G 11: 87,634,084 (GRCm39) E100G probably damaging Het
Teddm2 T C 1: 153,726,320 (GRCm39) I132V probably benign Het
Tmem131 C T 1: 36,832,054 (GRCm39) G1861E possibly damaging Het
Tpr A T 1: 150,299,358 (GRCm39) H1186L probably benign Het
Trim34b A T 7: 103,978,743 (GRCm39) probably benign Het
Trpm2 T C 10: 77,748,426 (GRCm39) M1415V probably benign Het
Ttll12 A G 15: 83,471,086 (GRCm39) F264S probably benign Het
Vmn2r59 T C 7: 41,695,644 (GRCm39) E256G probably benign Het
Vmn2r93 A T 17: 18,546,672 (GRCm39) H848L probably benign Het
Vps35l T C 7: 118,372,315 (GRCm39) S290P probably damaging Het
Wdfy3 G A 5: 102,055,384 (GRCm39) T1562I probably damaging Het
Ybey T C 10: 76,304,197 (GRCm39) S2G possibly damaging Het
Zfp346 A T 13: 55,280,200 (GRCm39) Q308L probably benign Het
Other mutations in Mug1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Mug1 APN 6 121,842,768 (GRCm39) missense probably damaging 1.00
IGL00485:Mug1 APN 6 121,864,375 (GRCm39) missense probably benign 0.17
IGL00816:Mug1 APN 6 121,859,597 (GRCm39) missense probably damaging 0.99
IGL01140:Mug1 APN 6 121,859,693 (GRCm39) missense probably benign 0.01
IGL01141:Mug1 APN 6 121,847,458 (GRCm39) missense probably benign 0.08
IGL01384:Mug1 APN 6 121,826,433 (GRCm39) splice site probably benign
IGL01659:Mug1 APN 6 121,847,619 (GRCm39) splice site probably benign
IGL02049:Mug1 APN 6 121,848,295 (GRCm39) missense probably benign
IGL02151:Mug1 APN 6 121,861,649 (GRCm39) critical splice donor site probably null
IGL02315:Mug1 APN 6 121,817,126 (GRCm39) missense probably benign
IGL02629:Mug1 APN 6 121,817,024 (GRCm39) missense possibly damaging 0.62
IGL02642:Mug1 APN 6 121,859,544 (GRCm39) missense probably benign 0.14
IGL02807:Mug1 APN 6 121,863,531 (GRCm39) missense probably damaging 0.96
IGL02932:Mug1 APN 6 121,864,386 (GRCm39) missense probably benign 0.35
IGL03232:Mug1 APN 6 121,855,494 (GRCm39) missense probably benign 0.00
R1462_Mug1_304 UTSW 6 121,859,588 (GRCm39) missense probably benign 0.41
R2341_Mug1_749 UTSW 6 121,861,588 (GRCm39) missense probably benign 0.06
R4261_Mug1_652 UTSW 6 121,850,693 (GRCm39) missense probably benign
R6173_mug1_139 UTSW 6 121,840,752 (GRCm39) missense probably damaging 0.99
IGL03050:Mug1 UTSW 6 121,857,530 (GRCm39) missense possibly damaging 0.90
R0101:Mug1 UTSW 6 121,861,206 (GRCm39) missense possibly damaging 0.59
R0194:Mug1 UTSW 6 121,817,066 (GRCm39) missense probably damaging 0.98
R0196:Mug1 UTSW 6 121,815,684 (GRCm39) critical splice donor site probably null
R0325:Mug1 UTSW 6 121,826,801 (GRCm39) missense probably benign
R0332:Mug1 UTSW 6 121,826,856 (GRCm39) splice site probably null
R0377:Mug1 UTSW 6 121,834,320 (GRCm39) missense probably benign 0.02
R0393:Mug1 UTSW 6 121,826,809 (GRCm39) missense possibly damaging 0.64
R0414:Mug1 UTSW 6 121,833,513 (GRCm39) missense probably benign 0.00
R0457:Mug1 UTSW 6 121,838,514 (GRCm39) missense probably benign 0.06
R0479:Mug1 UTSW 6 121,817,186 (GRCm39) missense probably benign
R0519:Mug1 UTSW 6 121,828,383 (GRCm39) missense possibly damaging 0.83
R0535:Mug1 UTSW 6 121,828,413 (GRCm39) missense probably benign
R0745:Mug1 UTSW 6 121,864,386 (GRCm39) missense probably benign 0.35
R0939:Mug1 UTSW 6 121,861,308 (GRCm39) missense possibly damaging 0.95
R0975:Mug1 UTSW 6 121,855,498 (GRCm39) missense probably damaging 0.99
R1033:Mug1 UTSW 6 121,857,510 (GRCm39) missense probably damaging 0.99
R1086:Mug1 UTSW 6 121,862,813 (GRCm39) missense probably damaging 1.00
R1116:Mug1 UTSW 6 121,847,604 (GRCm39) missense probably benign
R1131:Mug1 UTSW 6 121,838,144 (GRCm39) missense probably benign 0.18
R1249:Mug1 UTSW 6 121,826,420 (GRCm39) missense probably benign 0.07
R1364:Mug1 UTSW 6 121,858,672 (GRCm39) missense probably damaging 1.00
R1418:Mug1 UTSW 6 121,815,635 (GRCm39) missense probably benign 0.00
R1462:Mug1 UTSW 6 121,859,588 (GRCm39) missense probably benign 0.41
R1462:Mug1 UTSW 6 121,859,588 (GRCm39) missense probably benign 0.41
R1494:Mug1 UTSW 6 121,856,259 (GRCm39) missense probably damaging 1.00
R1639:Mug1 UTSW 6 121,857,530 (GRCm39) missense probably damaging 1.00
R1901:Mug1 UTSW 6 121,858,780 (GRCm39) missense probably benign
R1902:Mug1 UTSW 6 121,858,780 (GRCm39) missense probably benign
R2087:Mug1 UTSW 6 121,833,250 (GRCm39) missense probably benign 0.00
R2168:Mug1 UTSW 6 121,847,458 (GRCm39) missense probably benign 0.08
R2249:Mug1 UTSW 6 121,847,469 (GRCm39) missense probably benign
R2341:Mug1 UTSW 6 121,861,588 (GRCm39) missense probably benign 0.06
R2888:Mug1 UTSW 6 121,858,802 (GRCm39) missense probably benign 0.44
R2892:Mug1 UTSW 6 121,817,029 (GRCm39) missense possibly damaging 0.91
R3703:Mug1 UTSW 6 121,865,515 (GRCm39) splice site probably benign
R3789:Mug1 UTSW 6 121,861,587 (GRCm39) missense probably benign 0.03
R3790:Mug1 UTSW 6 121,861,587 (GRCm39) missense probably benign 0.03
R3950:Mug1 UTSW 6 121,855,489 (GRCm39) missense probably damaging 1.00
R4261:Mug1 UTSW 6 121,850,693 (GRCm39) missense probably benign
R4402:Mug1 UTSW 6 121,856,311 (GRCm39) missense probably damaging 1.00
R4589:Mug1 UTSW 6 121,834,310 (GRCm39) missense probably benign 0.19
R4707:Mug1 UTSW 6 121,861,600 (GRCm39) missense probably damaging 1.00
R4766:Mug1 UTSW 6 121,861,213 (GRCm39) missense probably benign 0.01
R4840:Mug1 UTSW 6 121,862,813 (GRCm39) missense probably damaging 1.00
R4984:Mug1 UTSW 6 121,815,576 (GRCm39) utr 5 prime probably benign
R4999:Mug1 UTSW 6 121,855,902 (GRCm39) nonsense probably null
R5198:Mug1 UTSW 6 121,851,521 (GRCm39) missense probably damaging 1.00
R5220:Mug1 UTSW 6 121,838,092 (GRCm39) missense probably benign 0.03
R5253:Mug1 UTSW 6 121,865,872 (GRCm39) missense probably benign 0.03
R5273:Mug1 UTSW 6 121,850,748 (GRCm39) missense probably damaging 0.99
R5285:Mug1 UTSW 6 121,818,066 (GRCm39) missense probably benign 0.45
R5387:Mug1 UTSW 6 121,861,353 (GRCm39) missense probably damaging 0.99
R5560:Mug1 UTSW 6 121,838,032 (GRCm39) missense probably damaging 0.96
R5652:Mug1 UTSW 6 121,817,140 (GRCm39) missense probably benign
R5704:Mug1 UTSW 6 121,828,392 (GRCm39) missense possibly damaging 0.63
R5732:Mug1 UTSW 6 121,855,452 (GRCm39) missense probably benign 0.00
R6053:Mug1 UTSW 6 121,842,697 (GRCm39) missense probably benign 0.00
R6173:Mug1 UTSW 6 121,840,752 (GRCm39) missense probably damaging 0.99
R6578:Mug1 UTSW 6 121,864,411 (GRCm39) missense probably benign 0.00
R6647:Mug1 UTSW 6 121,817,200 (GRCm39) missense probably benign 0.02
R6681:Mug1 UTSW 6 121,815,683 (GRCm39) missense possibly damaging 0.75
R6925:Mug1 UTSW 6 121,858,746 (GRCm39) missense probably damaging 1.00
R7014:Mug1 UTSW 6 121,838,084 (GRCm39) missense probably benign 0.22
R7031:Mug1 UTSW 6 121,815,673 (GRCm39) missense probably benign 0.00
R7156:Mug1 UTSW 6 121,861,302 (GRCm39) missense probably damaging 1.00
R7156:Mug1 UTSW 6 121,857,864 (GRCm39) missense probably damaging 1.00
R7179:Mug1 UTSW 6 121,834,379 (GRCm39) missense probably benign 0.00
R7211:Mug1 UTSW 6 121,857,498 (GRCm39) missense possibly damaging 0.52
R7318:Mug1 UTSW 6 121,847,611 (GRCm39) critical splice donor site probably null
R7462:Mug1 UTSW 6 121,852,399 (GRCm39) missense probably benign 0.00
R7479:Mug1 UTSW 6 121,855,467 (GRCm39) missense possibly damaging 0.83
R7588:Mug1 UTSW 6 121,852,476 (GRCm39) missense probably damaging 1.00
R7611:Mug1 UTSW 6 121,852,387 (GRCm39) critical splice acceptor site probably null
R7659:Mug1 UTSW 6 121,838,179 (GRCm39) missense possibly damaging 0.95
R7660:Mug1 UTSW 6 121,838,179 (GRCm39) missense possibly damaging 0.95
R7661:Mug1 UTSW 6 121,838,179 (GRCm39) missense possibly damaging 0.95
R7663:Mug1 UTSW 6 121,838,179 (GRCm39) missense possibly damaging 0.95
R7664:Mug1 UTSW 6 121,838,179 (GRCm39) missense possibly damaging 0.95
R7666:Mug1 UTSW 6 121,838,179 (GRCm39) missense possibly damaging 0.95
R7788:Mug1 UTSW 6 121,838,179 (GRCm39) missense possibly damaging 0.95
R7789:Mug1 UTSW 6 121,838,179 (GRCm39) missense possibly damaging 0.95
R7794:Mug1 UTSW 6 121,833,247 (GRCm39) missense possibly damaging 0.93
R7809:Mug1 UTSW 6 121,855,944 (GRCm39) missense possibly damaging 0.79
R7836:Mug1 UTSW 6 121,847,611 (GRCm39) critical splice donor site probably null
R7867:Mug1 UTSW 6 121,850,593 (GRCm39) missense probably benign
R7904:Mug1 UTSW 6 121,828,424 (GRCm39) missense probably benign
R7937:Mug1 UTSW 6 121,838,128 (GRCm39) missense probably benign 0.00
R7981:Mug1 UTSW 6 121,858,723 (GRCm39) missense probably damaging 1.00
R7999:Mug1 UTSW 6 121,857,855 (GRCm39) missense possibly damaging 0.90
R8070:Mug1 UTSW 6 121,852,838 (GRCm39) missense probably benign 0.26
R8071:Mug1 UTSW 6 121,850,631 (GRCm39) missense probably benign
R8151:Mug1 UTSW 6 121,818,117 (GRCm39) missense probably benign 0.01
R8491:Mug1 UTSW 6 121,859,688 (GRCm39) missense probably damaging 1.00
R8714:Mug1 UTSW 6 121,859,681 (GRCm39) missense probably benign 0.01
R8734:Mug1 UTSW 6 121,848,340 (GRCm39) missense probably benign 0.00
R8738:Mug1 UTSW 6 121,817,208 (GRCm39) splice site probably benign
R8807:Mug1 UTSW 6 121,851,434 (GRCm39) missense probably benign 0.27
R8931:Mug1 UTSW 6 121,861,296 (GRCm39) missense probably benign
R8940:Mug1 UTSW 6 121,858,642 (GRCm39) missense
R9156:Mug1 UTSW 6 121,851,390 (GRCm39) missense probably damaging 0.99
R9314:Mug1 UTSW 6 121,834,296 (GRCm39) missense probably damaging 0.97
R9315:Mug1 UTSW 6 121,850,730 (GRCm39) missense possibly damaging 0.95
R9330:Mug1 UTSW 6 121,859,723 (GRCm39) missense probably benign 0.14
R9334:Mug1 UTSW 6 121,838,490 (GRCm39) missense probably benign 0.01
R9357:Mug1 UTSW 6 121,852,450 (GRCm39) missense probably benign 0.02
R9515:Mug1 UTSW 6 121,861,635 (GRCm39) missense probably damaging 1.00
R9549:Mug1 UTSW 6 121,858,762 (GRCm39) missense probably damaging 1.00
R9564:Mug1 UTSW 6 121,861,587 (GRCm39) missense probably benign 0.03
R9663:Mug1 UTSW 6 121,859,699 (GRCm39) missense probably benign 0.03
R9663:Mug1 UTSW 6 121,857,463 (GRCm39) missense probably benign 0.08
R9681:Mug1 UTSW 6 121,833,254 (GRCm39) missense probably benign 0.01
R9777:Mug1 UTSW 6 121,857,864 (GRCm39) missense probably damaging 1.00
RF017:Mug1 UTSW 6 121,861,533 (GRCm39) missense probably damaging 1.00
X0064:Mug1 UTSW 6 121,838,174 (GRCm39) missense possibly damaging 0.48
Z1176:Mug1 UTSW 6 121,857,452 (GRCm39) missense probably damaging 1.00
Z1176:Mug1 UTSW 6 121,818,253 (GRCm39) missense probably benign 0.32
Z1177:Mug1 UTSW 6 121,856,258 (GRCm39) critical splice acceptor site probably null
Z1177:Mug1 UTSW 6 121,840,767 (GRCm39) missense probably damaging 0.99
Z1177:Mug1 UTSW 6 121,863,527 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACAGTCTCCTCCAAAATGAGTG -3'
(R):5'- TCCATGTAAGACTGCTTCACC -3'

Sequencing Primer
(F):5'- CTCCTCCAAAATGAGTGATTCAATGC -3'
(R):5'- ACCTACTACTCAATATGGTGATCCTG -3'
Posted On 2019-05-13