Incidental Mutation 'R7034:Pcnx2'
ID546536
Institutional Source Beutler Lab
Gene Symbol Pcnx2
Ensembl Gene ENSMUSG00000060212
Gene Namepecanex homolog 2
SynonymsPcnxl2, E330039K12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7034 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location125751508-125898317 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125785302 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1422 (T1422A)
Ref Sequence ENSEMBL: ENSMUSP00000042294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047239]
Predicted Effect probably damaging
Transcript: ENSMUST00000047239
AA Change: T1422A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042294
Gene: ENSMUSG00000060212
AA Change: T1422A

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
low complexity region 391 415 N/A INTRINSIC
low complexity region 457 476 N/A INTRINSIC
low complexity region 727 742 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
transmembrane domain 823 842 N/A INTRINSIC
transmembrane domain 849 866 N/A INTRINSIC
transmembrane domain 881 902 N/A INTRINSIC
transmembrane domain 934 956 N/A INTRINSIC
transmembrane domain 976 998 N/A INTRINSIC
transmembrane domain 1011 1030 N/A INTRINSIC
transmembrane domain 1080 1102 N/A INTRINSIC
transmembrane domain 1104 1126 N/A INTRINSIC
Pfam:Pecanex_C 1603 1828 3.5e-113 PFAM
low complexity region 1864 1889 N/A INTRINSIC
low complexity region 1968 1981 N/A INTRINSIC
low complexity region 2004 2019 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains coding mononucleotide repeats that are associated with tumors of high mcrosatellite instability (MSI-H). Defects in this gene are involved in the tumorigenesis of MSI-H colorectal carcinomas. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,609,256 probably null Het
9030624J02Rik T C 7: 118,773,092 S290P probably damaging Het
9130011E15Rik A G 19: 45,965,249 I195T probably damaging Het
Adamts1 T A 16: 85,802,746 probably benign Het
Aff4 A G 11: 53,408,409 K979E probably damaging Het
Aftph A T 11: 20,692,498 M845K probably damaging Het
Akt2 T C 7: 27,637,012 probably null Het
Aldh1a7 A T 19: 20,708,178 L336Q possibly damaging Het
Ank3 C T 10: 69,999,379 T680M probably damaging Het
Apeh T C 9: 108,094,271 E59G possibly damaging Het
Armc8 C T 9: 99,483,965 probably null Het
Atp2b1 C T 10: 98,987,310 T244I probably damaging Het
Btaf1 C A 19: 37,004,469 T1633K probably benign Het
Cacng8 A G 7: 3,415,303 S324G probably benign Het
Calcr T A 6: 3,692,543 Q400L probably damaging Het
Caprin2 G A 6: 148,848,205 P536S possibly damaging Het
Ccdc54 A T 16: 50,590,588 M105K probably benign Het
Ccna1 T C 3: 55,046,039 E381G possibly damaging Het
Cd2ap A T 17: 42,798,599 L623Q probably damaging Het
Cdkl3 A G 11: 52,027,215 E415G probably benign Het
Chd5 C A 4: 152,360,941 L430I possibly damaging Het
Clspn G A 4: 126,580,982 E975K possibly damaging Het
Cobl C A 11: 12,254,177 V835F probably damaging Het
D430041D05Rik C A 2: 104,192,538 R1037L probably damaging Het
Derl1 A G 15: 57,879,047 probably null Het
Dhrs9 T G 2: 69,393,176 N89K probably benign Het
Erich1 A G 8: 14,064,330 I60T probably benign Het
Fam126b T A 1: 58,535,537 M282L probably benign Het
Fam155a G A 8: 9,770,589 P144S possibly damaging Het
Fam184a A T 10: 53,694,814 S408T possibly damaging Het
Fcgr4 T A 1: 171,020,088 M85K probably benign Het
Foxj3 A G 4: 119,619,300 E259G probably damaging Het
Galnt11 T C 5: 25,258,813 I361T probably damaging Het
Gck A G 11: 5,901,747 S441P probably damaging Het
Gdap1l1 G T 2: 163,446,145 V98F probably damaging Het
Gm13089 A T 4: 143,697,328 I297N probably damaging Het
Gm884 T A 11: 103,615,812 probably benign Het
Gramd1a A G 7: 31,132,756 probably null Het
Herc3 A T 6: 58,876,855 M629L probably benign Het
Hist2h2ab C T 3: 96,219,988 Q25* probably null Het
Hoxc12 G A 15: 102,938,360 G229D probably damaging Het
Itga9 T C 9: 118,698,365 L528P probably benign Het
Krt39 A C 11: 99,521,236 V8G probably benign Het
Krt71 A G 15: 101,738,337 I312T probably benign Het
Mllt11 A G 3: 95,220,433 Y9H probably damaging Het
Mrgpra3 G T 7: 47,590,090 N29K possibly damaging Het
Mug1 A G 6: 121,873,644 T700A probably benign Het
Myl1 T C 1: 66,930,236 N79S probably damaging Het
Myo18b G A 5: 112,723,904 Q2104* probably null Het
Ndufs2 T C 1: 171,238,308 D256G probably benign Het
Nek5 T C 8: 22,107,723 N280S probably benign Het
Nwd2 A T 5: 63,804,915 N614I probably damaging Het
Olfr794 G A 10: 129,571,072 C139Y possibly damaging Het
Parp1 G T 1: 180,598,252 K849N possibly damaging Het
Plce1 A G 19: 38,739,357 N1520S probably damaging Het
Ppcdc T C 9: 57,415,170 T149A probably damaging Het
Ppl A G 16: 5,087,502 V1643A probably benign Het
Prrx1 T A 1: 163,248,338 M220L probably benign Het
Pspc1 A C 14: 56,758,628 probably null Het
Ptpn20 A G 14: 33,614,435 *44W probably null Het
Qars T A 9: 108,514,777 V83E probably damaging Het
Rbm33 T C 5: 28,394,498 M956T unknown Het
Sash1 C A 10: 8,730,083 E848* probably null Het
Scai T A 2: 39,121,135 Y163F probably damaging Het
Serpinf2 A T 11: 75,438,418 probably benign Het
Sgo2b T A 8: 63,926,834 H988L probably benign Het
Sh2b2 G A 5: 136,218,885 T604I probably benign Het
Skint4 A T 4: 112,158,084 I449F possibly damaging Het
Slc30a2 A G 4: 134,347,342 I88V possibly damaging Het
Smug1 A G 15: 103,155,942 L184P probably damaging Het
Spatc1 A G 15: 76,283,880 T180A probably benign Het
Ssr1 A T 13: 37,994,025 L20Q probably null Het
Supt4a A G 11: 87,743,258 E100G probably damaging Het
Teddm2 T C 1: 153,850,574 I132V probably benign Het
Tmem131 C T 1: 36,792,973 G1861E possibly damaging Het
Tpr A T 1: 150,423,607 H1186L probably benign Het
Trim34b A T 7: 104,329,536 probably benign Het
Trpm2 T C 10: 77,912,592 M1415V probably benign Het
Ttll12 A G 15: 83,586,885 F264S probably benign Het
Vmn2r59 T C 7: 42,046,220 E256G probably benign Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Wdfy3 G A 5: 101,907,518 T1562I probably damaging Het
Ybey T C 10: 76,468,363 S2G possibly damaging Het
Zfp346 A T 13: 55,132,387 Q308L probably benign Het
Other mutations in Pcnx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Pcnx2 APN 8 125887585 missense probably damaging 1.00
IGL00900:Pcnx2 APN 8 125863236 splice site probably benign
IGL01134:Pcnx2 APN 8 125863150 missense probably benign
IGL01370:Pcnx2 APN 8 125801483 missense probably damaging 0.96
IGL01452:Pcnx2 APN 8 125838032 missense probably damaging 1.00
IGL01477:Pcnx2 APN 8 125785305 missense probably damaging 1.00
IGL01610:Pcnx2 APN 8 125839633 missense possibly damaging 0.67
IGL01640:Pcnx2 APN 8 125801558 missense probably benign 0.14
IGL01645:Pcnx2 APN 8 125887917 missense probably damaging 1.00
IGL01876:Pcnx2 APN 8 125866031 missense probably benign 0.31
IGL01933:Pcnx2 APN 8 125761654 missense probably damaging 1.00
IGL02208:Pcnx2 APN 8 125752155 missense probably benign 0.30
IGL02573:Pcnx2 APN 8 125855273 missense probably benign 0.34
IGL02810:Pcnx2 APN 8 125887203 missense probably benign 0.03
IGL02859:Pcnx2 APN 8 125863173 missense probably damaging 1.00
IGL02879:Pcnx2 APN 8 125772057 missense probably damaging 1.00
IGL03202:Pcnx2 APN 8 125772044 missense probably damaging 0.98
IGL03259:Pcnx2 APN 8 125753649 missense probably benign 0.19
IGL03395:Pcnx2 APN 8 125887523 missense probably benign 0.00
IGL03410:Pcnx2 APN 8 125887040 missense probably damaging 1.00
gallen UTSW 8 125891120 missense probably damaging 1.00
hotzone UTSW 8 125891141 missense probably benign 0.00
R0107:Pcnx2 UTSW 8 125753586 missense probably benign 0.29
R0477:Pcnx2 UTSW 8 125761567 missense probably damaging 0.99
R0610:Pcnx2 UTSW 8 125839687 missense probably damaging 1.00
R0645:Pcnx2 UTSW 8 125760720 missense possibly damaging 0.64
R0894:Pcnx2 UTSW 8 125886926 splice site probably benign
R1083:Pcnx2 UTSW 8 125772104 missense probably damaging 1.00
R1199:Pcnx2 UTSW 8 125887314 missense possibly damaging 0.60
R1296:Pcnx2 UTSW 8 125773833 missense probably damaging 1.00
R1445:Pcnx2 UTSW 8 125752284 missense probably damaging 0.99
R1467:Pcnx2 UTSW 8 125753550 missense possibly damaging 0.77
R1467:Pcnx2 UTSW 8 125753550 missense possibly damaging 0.77
R1524:Pcnx2 UTSW 8 125891141 missense probably benign 0.00
R1537:Pcnx2 UTSW 8 125877449 missense possibly damaging 0.94
R1574:Pcnx2 UTSW 8 125773930 missense probably damaging 1.00
R1574:Pcnx2 UTSW 8 125773930 missense probably damaging 1.00
R1593:Pcnx2 UTSW 8 125759273 missense probably benign 0.11
R1598:Pcnx2 UTSW 8 125772086 missense probably benign 0.03
R1603:Pcnx2 UTSW 8 125839626 missense probably damaging 1.00
R1697:Pcnx2 UTSW 8 125850348 missense probably damaging 1.00
R1759:Pcnx2 UTSW 8 125773978 missense probably damaging 1.00
R1855:Pcnx2 UTSW 8 125807996 splice site probably benign
R1863:Pcnx2 UTSW 8 125818786 missense probably damaging 0.98
R1930:Pcnx2 UTSW 8 125887714 missense probably benign 0.10
R1967:Pcnx2 UTSW 8 125815683 missense possibly damaging 0.51
R1974:Pcnx2 UTSW 8 125887371 missense probably benign 0.00
R1998:Pcnx2 UTSW 8 125887143 missense probably damaging 1.00
R2034:Pcnx2 UTSW 8 125818667 critical splice donor site probably null
R2072:Pcnx2 UTSW 8 125761742 missense possibly damaging 0.90
R2096:Pcnx2 UTSW 8 125759248 missense probably benign 0.27
R2216:Pcnx2 UTSW 8 125888077 missense probably benign 0.00
R2290:Pcnx2 UTSW 8 125877595 splice site probably benign
R2373:Pcnx2 UTSW 8 125753451 missense probably damaging 1.00
R2484:Pcnx2 UTSW 8 125891120 missense probably damaging 1.00
R2849:Pcnx2 UTSW 8 125760927 missense probably damaging 1.00
R2891:Pcnx2 UTSW 8 125891058 missense probably damaging 1.00
R2892:Pcnx2 UTSW 8 125891058 missense probably damaging 1.00
R2970:Pcnx2 UTSW 8 125801536 missense probably damaging 1.00
R3013:Pcnx2 UTSW 8 125887770 missense probably benign 0.05
R3608:Pcnx2 UTSW 8 125888101 missense probably benign
R3876:Pcnx2 UTSW 8 125888158 missense probably benign
R4349:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4352:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4353:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4361:Pcnx2 UTSW 8 125768298 nonsense probably null
R4735:Pcnx2 UTSW 8 125828041 critical splice donor site probably null
R4749:Pcnx2 UTSW 8 125887588 missense probably damaging 1.00
R4812:Pcnx2 UTSW 8 125865939 missense probably benign 0.00
R4819:Pcnx2 UTSW 8 125855230 missense probably benign 0.04
R4829:Pcnx2 UTSW 8 125861058 splice site probably null
R4832:Pcnx2 UTSW 8 125752188 missense probably damaging 0.99
R4876:Pcnx2 UTSW 8 125772108 missense probably damaging 1.00
R4974:Pcnx2 UTSW 8 125851130 missense probably benign 0.00
R5057:Pcnx2 UTSW 8 125855191 missense possibly damaging 0.95
R5078:Pcnx2 UTSW 8 125752156 missense probably benign
R5114:Pcnx2 UTSW 8 125838010 missense possibly damaging 0.89
R5195:Pcnx2 UTSW 8 125801549 missense possibly damaging 0.69
R5239:Pcnx2 UTSW 8 125861082 splice site probably null
R5348:Pcnx2 UTSW 8 125818756 missense probably damaging 1.00
R5398:Pcnx2 UTSW 8 125887948 missense possibly damaging 0.63
R5448:Pcnx2 UTSW 8 125888149 missense probably benign 0.14
R5534:Pcnx2 UTSW 8 125838015 missense possibly damaging 0.65
R5624:Pcnx2 UTSW 8 125761523 critical splice donor site probably null
R5629:Pcnx2 UTSW 8 125898041 missense probably damaging 1.00
R5630:Pcnx2 UTSW 8 125860958 missense probably damaging 0.99
R5782:Pcnx2 UTSW 8 125753484 missense probably damaging 1.00
R5877:Pcnx2 UTSW 8 125753728 missense probably damaging 0.99
R5879:Pcnx2 UTSW 8 125773946 missense probably damaging 1.00
R6114:Pcnx2 UTSW 8 125773947 missense probably damaging 1.00
R6152:Pcnx2 UTSW 8 125753752 missense probably damaging 0.99
R6154:Pcnx2 UTSW 8 125762813 missense probably damaging 1.00
R6283:Pcnx2 UTSW 8 125877586 missense probably damaging 0.99
R6500:Pcnx2 UTSW 8 125753485 missense probably damaging 1.00
R6629:Pcnx2 UTSW 8 125891112 missense probably benign 0.00
R6708:Pcnx2 UTSW 8 125860953 critical splice donor site probably null
R6736:Pcnx2 UTSW 8 125752317 splice site probably null
R6748:Pcnx2 UTSW 8 125850335 missense probably damaging 1.00
R6788:Pcnx2 UTSW 8 125772100 missense probably damaging 1.00
R6849:Pcnx2 UTSW 8 125861210 missense probably damaging 1.00
R6947:Pcnx2 UTSW 8 125850282 critical splice donor site probably null
R7100:Pcnx2 UTSW 8 125759114 missense probably benign 0.16
R7124:Pcnx2 UTSW 8 125753617 missense probably damaging 0.99
R7130:Pcnx2 UTSW 8 125753584 nonsense probably null
R7133:Pcnx2 UTSW 8 125801504 missense probably benign 0.01
R7271:Pcnx2 UTSW 8 125886951 missense probably benign
R7326:Pcnx2 UTSW 8 125887083 missense probably damaging 1.00
R7373:Pcnx2 UTSW 8 125808027 missense probably damaging 1.00
R7397:Pcnx2 UTSW 8 125890885 splice site probably null
R7662:Pcnx2 UTSW 8 125818771 nonsense probably null
R7693:Pcnx2 UTSW 8 125887125 missense probably benign 0.09
R7726:Pcnx2 UTSW 8 125850330 missense probably benign 0.00
R7745:Pcnx2 UTSW 8 125851107 missense probably benign 0.04
R7792:Pcnx2 UTSW 8 125892018 missense possibly damaging 0.63
R7797:Pcnx2 UTSW 8 125785348 missense possibly damaging 0.70
R7921:Pcnx2 UTSW 8 125837863 missense probably benign
R7984:Pcnx2 UTSW 8 125759126 missense probably benign
R8098:Pcnx2 UTSW 8 125768301 missense probably damaging 1.00
R8277:Pcnx2 UTSW 8 125866016 missense probably damaging 1.00
R8312:Pcnx2 UTSW 8 125762850 missense possibly damaging 0.69
R8354:Pcnx2 UTSW 8 125761618 missense probably damaging 0.99
R8378:Pcnx2 UTSW 8 125760910 missense probably damaging 1.00
R8713:Pcnx2 UTSW 8 125818786 missense probably damaging 1.00
R8714:Pcnx2 UTSW 8 125773807 missense probably benign
R8753:Pcnx2 UTSW 8 125887260 missense probably benign 0.15
R8790:Pcnx2 UTSW 8 125877567 missense probably benign
R8925:Pcnx2 UTSW 8 125887920 missense probably benign 0.01
R8927:Pcnx2 UTSW 8 125887920 missense probably benign 0.01
RF018:Pcnx2 UTSW 8 125877519 missense probably damaging 1.00
Z1088:Pcnx2 UTSW 8 125826928 missense probably damaging 1.00
Z1088:Pcnx2 UTSW 8 125866018 missense probably damaging 1.00
Z1176:Pcnx2 UTSW 8 125761654 missense probably damaging 1.00
Z1176:Pcnx2 UTSW 8 125838014 missense probably benign 0.30
Z1177:Pcnx2 UTSW 8 125887960 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACAGTCCCCGAGTCTTTTG -3'
(R):5'- GGGAGTGATGACAACAACCTC -3'

Sequencing Primer
(F):5'- GTCCTCTGCAAGAGTAGTACATGC -3'
(R):5'- GGAGTGATGACAACAACCTCAACTC -3'
Posted On2019-05-13