Mutagenetix > Incidental Mutation

Incidental Mutation 'R7034:Pcnx2'

546536

Institutional Source

Beutler Lab

Gene Symbol

Pcnx2

Ensembl Gene

ENSMUSG00000060212

Gene Name

pecanex homolog 2

Synonyms

Pcnxl2, E330039K12Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7034 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

125751508-125898317 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 125785302 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1422 (T1422A)

Ref Sequence

ENSEMBL: ENSMUSP00000042294 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047239]

AlphaFold

Q5DU28

Predicted Effect

probably damaging
Transcript: ENSMUST00000047239
AA Change: T1422A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000042294
Gene: ENSMUSG00000060212
AA Change: T1422A

Domain	Start	End	E-Value	Type
transmembrane domain	36	53	N/A	INTRINSIC
transmembrane domain	60	82	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
low complexity region	391	415	N/A	INTRINSIC
low complexity region	457	476	N/A	INTRINSIC
low complexity region	727	742	N/A	INTRINSIC
low complexity region	806	817	N/A	INTRINSIC
transmembrane domain	823	842	N/A	INTRINSIC
transmembrane domain	849	866	N/A	INTRINSIC
transmembrane domain	881	902	N/A	INTRINSIC
transmembrane domain	934	956	N/A	INTRINSIC
transmembrane domain	976	998	N/A	INTRINSIC
transmembrane domain	1011	1030	N/A	INTRINSIC
transmembrane domain	1080	1102	N/A	INTRINSIC
transmembrane domain	1104	1126	N/A	INTRINSIC
Pfam:Pecanex_C	1603	1828	3.5e-113	PFAM
low complexity region	1864	1889	N/A	INTRINSIC
low complexity region	1968	1981	N/A	INTRINSIC
low complexity region	2004	2019	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains coding mononucleotide repeats that are associated with tumors of high mcrosatellite instability (MSI-H). Defects in this gene are involved in the tumorigenesis of MSI-H colorectal carcinomas. [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	T	A	10: 100,609,256		probably null	Het
9030624J02Rik	T	C	7: 118,773,092	S290P	probably damaging	Het
9130011E15Rik	A	G	19: 45,965,249	I195T	probably damaging	Het
Adamts1	T	A	16: 85,802,746		probably benign	Het
Aff4	A	G	11: 53,408,409	K979E	probably damaging	Het
Aftph	A	T	11: 20,692,498	M845K	probably damaging	Het
Akt2	T	C	7: 27,637,012		probably null	Het
Aldh1a7	A	T	19: 20,708,178	L336Q	possibly damaging	Het
Ank3	C	T	10: 69,999,379	T680M	probably damaging	Het
Apeh	T	C	9: 108,094,271	E59G	possibly damaging	Het
Armc8	C	T	9: 99,483,965		probably null	Het
Atp2b1	C	T	10: 98,987,310	T244I	probably damaging	Het
Btaf1	C	A	19: 37,004,469	T1633K	probably benign	Het
Cacng8	A	G	7: 3,415,303	S324G	probably benign	Het
Calcr	T	A	6: 3,692,543	Q400L	probably damaging	Het
Caprin2	G	A	6: 148,848,205	P536S	possibly damaging	Het
Ccdc54	A	T	16: 50,590,588	M105K	probably benign	Het
Ccna1	T	C	3: 55,046,039	E381G	possibly damaging	Het
Cd2ap	A	T	17: 42,798,599	L623Q	probably damaging	Het
Cdkl3	A	G	11: 52,027,215	E415G	probably benign	Het
Chd5	C	A	4: 152,360,941	L430I	possibly damaging	Het
Clspn	G	A	4: 126,580,982	E975K	possibly damaging	Het
Cobl	C	A	11: 12,254,177	V835F	probably damaging	Het
D430041D05Rik	C	A	2: 104,192,538	R1037L	probably damaging	Het
Derl1	A	G	15: 57,879,047		probably null	Het
Dhrs9	T	G	2: 69,393,176	N89K	probably benign	Het
Erich1	A	G	8: 14,064,330	I60T	probably benign	Het
Fam126b	T	A	1: 58,535,537	M282L	probably benign	Het
Fam155a	G	A	8: 9,770,589	P144S	possibly damaging	Het
Fam184a	A	T	10: 53,694,814	S408T	possibly damaging	Het
Fcgr4	T	A	1: 171,020,088	M85K	probably benign	Het
Foxj3	A	G	4: 119,619,300	E259G	probably damaging	Het
Galnt11	T	C	5: 25,258,813	I361T	probably damaging	Het
Gck	A	G	11: 5,901,747	S441P	probably damaging	Het
Gdap1l1	G	T	2: 163,446,145	V98F	probably damaging	Het
Gm13089	A	T	4: 143,697,328	I297N	probably damaging	Het
Gm884	T	A	11: 103,615,812		probably benign	Het
Gramd1a	A	G	7: 31,132,756		probably null	Het
Herc3	A	T	6: 58,876,855	M629L	probably benign	Het
Hist2h2ab	C	T	3: 96,219,988	Q25*	probably null	Het
Hoxc12	G	A	15: 102,938,360	G229D	probably damaging	Het
Itga9	T	C	9: 118,698,365	L528P	probably benign	Het
Krt39	A	C	11: 99,521,236	V8G	probably benign	Het
Krt71	A	G	15: 101,738,337	I312T	probably benign	Het
Mllt11	A	G	3: 95,220,433	Y9H	probably damaging	Het
Mrgpra3	G	T	7: 47,590,090	N29K	possibly damaging	Het
Mug1	A	G	6: 121,873,644	T700A	probably benign	Het
Myl1	T	C	1: 66,930,236	N79S	probably damaging	Het
Myo18b	G	A	5: 112,723,904	Q2104*	probably null	Het
Ndufs2	T	C	1: 171,238,308	D256G	probably benign	Het
Nek5	T	C	8: 22,107,723	N280S	probably benign	Het
Nwd2	A	T	5: 63,804,915	N614I	probably damaging	Het
Olfr794	G	A	10: 129,571,072	C139Y	possibly damaging	Het
Parp1	G	T	1: 180,598,252	K849N	possibly damaging	Het
Plce1	A	G	19: 38,739,357	N1520S	probably damaging	Het
Ppcdc	T	C	9: 57,415,170	T149A	probably damaging	Het
Ppl	A	G	16: 5,087,502	V1643A	probably benign	Het
Prrx1	T	A	1: 163,248,338	M220L	probably benign	Het
Pspc1	A	C	14: 56,758,628		probably null	Het
Ptpn20	A	G	14: 33,614,435	*44W	probably null	Het
Qars	T	A	9: 108,514,777	V83E	probably damaging	Het
Rbm33	T	C	5: 28,394,498	M956T	unknown	Het
Sash1	C	A	10: 8,730,083	E848*	probably null	Het
Scai	T	A	2: 39,121,135	Y163F	probably damaging	Het
Serpinf2	A	T	11: 75,438,418		probably benign	Het
Sgo2b	T	A	8: 63,926,834	H988L	probably benign	Het
Sh2b2	G	A	5: 136,218,885	T604I	probably benign	Het
Skint4	A	T	4: 112,158,084	I449F	possibly damaging	Het
Slc30a2	A	G	4: 134,347,342	I88V	possibly damaging	Het
Smug1	A	G	15: 103,155,942	L184P	probably damaging	Het
Spatc1	A	G	15: 76,283,880	T180A	probably benign	Het
Ssr1	A	T	13: 37,994,025	L20Q	probably null	Het
Supt4a	A	G	11: 87,743,258	E100G	probably damaging	Het
Teddm2	T	C	1: 153,850,574	I132V	probably benign	Het
Tmem131	C	T	1: 36,792,973	G1861E	possibly damaging	Het
Tpr	A	T	1: 150,423,607	H1186L	probably benign	Het
Trim34b	A	T	7: 104,329,536		probably benign	Het
Trpm2	T	C	10: 77,912,592	M1415V	probably benign	Het
Ttll12	A	G	15: 83,586,885	F264S	probably benign	Het
Vmn2r59	T	C	7: 42,046,220	E256G	probably benign	Het
Vmn2r93	A	T	17: 18,326,410	H848L	probably benign	Het
Wdfy3	G	A	5: 101,907,518	T1562I	probably damaging	Het
Ybey	T	C	10: 76,468,363	S2G	possibly damaging	Het
Zfp346	A	T	13: 55,132,387	Q308L	probably benign	Het

Other mutations in Pcnx2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Pcnx2	APN	8	125887585	missense	probably damaging	1.00
IGL00900:Pcnx2	APN	8	125863236	splice site	probably benign
IGL01134:Pcnx2	APN	8	125863150	missense	probably benign
IGL01370:Pcnx2	APN	8	125801483	missense	probably damaging	0.96
IGL01452:Pcnx2	APN	8	125838032	missense	probably damaging	1.00
IGL01477:Pcnx2	APN	8	125785305	missense	probably damaging	1.00
IGL01610:Pcnx2	APN	8	125839633	missense	possibly damaging	0.67
IGL01640:Pcnx2	APN	8	125801558	missense	probably benign	0.14
IGL01645:Pcnx2	APN	8	125887917	missense	probably damaging	1.00
IGL01876:Pcnx2	APN	8	125866031	missense	probably benign	0.31
IGL01933:Pcnx2	APN	8	125761654	missense	probably damaging	1.00
IGL02208:Pcnx2	APN	8	125752155	missense	probably benign	0.30
IGL02573:Pcnx2	APN	8	125855273	missense	probably benign	0.34
IGL02810:Pcnx2	APN	8	125887203	missense	probably benign	0.03
IGL02859:Pcnx2	APN	8	125863173	missense	probably damaging	1.00
IGL02879:Pcnx2	APN	8	125772057	missense	probably damaging	1.00
IGL03202:Pcnx2	APN	8	125772044	missense	probably damaging	0.98
IGL03259:Pcnx2	APN	8	125753649	missense	probably benign	0.19
IGL03395:Pcnx2	APN	8	125887523	missense	probably benign	0.00
IGL03410:Pcnx2	APN	8	125887040	missense	probably damaging	1.00
gallen	UTSW	8	125891120	missense	probably damaging	1.00
hotzone	UTSW	8	125891141	missense	probably benign	0.00
R0107:Pcnx2	UTSW	8	125753586	missense	probably benign	0.29
R0477:Pcnx2	UTSW	8	125761567	missense	probably damaging	0.99
R0610:Pcnx2	UTSW	8	125839687	missense	probably damaging	1.00
R0645:Pcnx2	UTSW	8	125760720	missense	possibly damaging	0.64
R0894:Pcnx2	UTSW	8	125886926	splice site	probably benign
R1083:Pcnx2	UTSW	8	125772104	missense	probably damaging	1.00
R1199:Pcnx2	UTSW	8	125887314	missense	possibly damaging	0.60
R1296:Pcnx2	UTSW	8	125773833	missense	probably damaging	1.00
R1445:Pcnx2	UTSW	8	125752284	missense	probably damaging	0.99
R1467:Pcnx2	UTSW	8	125753550	missense	possibly damaging	0.77
R1467:Pcnx2	UTSW	8	125753550	missense	possibly damaging	0.77
R1524:Pcnx2	UTSW	8	125891141	missense	probably benign	0.00
R1537:Pcnx2	UTSW	8	125877449	missense	possibly damaging	0.94
R1574:Pcnx2	UTSW	8	125773930	missense	probably damaging	1.00
R1574:Pcnx2	UTSW	8	125773930	missense	probably damaging	1.00
R1593:Pcnx2	UTSW	8	125759273	missense	probably benign	0.11
R1598:Pcnx2	UTSW	8	125772086	missense	probably benign	0.03
R1603:Pcnx2	UTSW	8	125839626	missense	probably damaging	1.00
R1697:Pcnx2	UTSW	8	125850348	missense	probably damaging	1.00
R1759:Pcnx2	UTSW	8	125773978	missense	probably damaging	1.00
R1855:Pcnx2	UTSW	8	125807996	splice site	probably benign
R1863:Pcnx2	UTSW	8	125818786	missense	probably damaging	0.98
R1930:Pcnx2	UTSW	8	125887714	missense	probably benign	0.10
R1967:Pcnx2	UTSW	8	125815683	missense	possibly damaging	0.51
R1974:Pcnx2	UTSW	8	125887371	missense	probably benign	0.00
R1998:Pcnx2	UTSW	8	125887143	missense	probably damaging	1.00
R2034:Pcnx2	UTSW	8	125818667	critical splice donor site	probably null
R2072:Pcnx2	UTSW	8	125761742	missense	possibly damaging	0.90
R2096:Pcnx2	UTSW	8	125759248	missense	probably benign	0.27
R2216:Pcnx2	UTSW	8	125888077	missense	probably benign	0.00
R2290:Pcnx2	UTSW	8	125877595	splice site	probably benign
R2373:Pcnx2	UTSW	8	125753451	missense	probably damaging	1.00
R2484:Pcnx2	UTSW	8	125891120	missense	probably damaging	1.00
R2849:Pcnx2	UTSW	8	125760927	missense	probably damaging	1.00
R2891:Pcnx2	UTSW	8	125891058	missense	probably damaging	1.00
R2892:Pcnx2	UTSW	8	125891058	missense	probably damaging	1.00
R2970:Pcnx2	UTSW	8	125801536	missense	probably damaging	1.00
R3013:Pcnx2	UTSW	8	125887770	missense	probably benign	0.05
R3608:Pcnx2	UTSW	8	125888101	missense	probably benign
R3876:Pcnx2	UTSW	8	125888158	missense	probably benign
R4349:Pcnx2	UTSW	8	125762851	missense	probably damaging	0.98
R4352:Pcnx2	UTSW	8	125762851	missense	probably damaging	0.98
R4353:Pcnx2	UTSW	8	125762851	missense	probably damaging	0.98
R4361:Pcnx2	UTSW	8	125768298	nonsense	probably null
R4735:Pcnx2	UTSW	8	125828041	critical splice donor site	probably null
R4749:Pcnx2	UTSW	8	125887588	missense	probably damaging	1.00
R4812:Pcnx2	UTSW	8	125865939	missense	probably benign	0.00
R4819:Pcnx2	UTSW	8	125855230	missense	probably benign	0.04
R4829:Pcnx2	UTSW	8	125861058	splice site	probably null
R4832:Pcnx2	UTSW	8	125752188	missense	probably damaging	0.99
R4876:Pcnx2	UTSW	8	125772108	missense	probably damaging	1.00
R4974:Pcnx2	UTSW	8	125851130	missense	probably benign	0.00
R5057:Pcnx2	UTSW	8	125855191	missense	possibly damaging	0.95
R5078:Pcnx2	UTSW	8	125752156	missense	probably benign
R5114:Pcnx2	UTSW	8	125838010	missense	possibly damaging	0.89
R5195:Pcnx2	UTSW	8	125801549	missense	possibly damaging	0.69
R5239:Pcnx2	UTSW	8	125861082	splice site	probably null
R5348:Pcnx2	UTSW	8	125818756	missense	probably damaging	1.00
R5398:Pcnx2	UTSW	8	125887948	missense	possibly damaging	0.63
R5448:Pcnx2	UTSW	8	125888149	missense	probably benign	0.14
R5534:Pcnx2	UTSW	8	125838015	missense	possibly damaging	0.65
R5624:Pcnx2	UTSW	8	125761523	critical splice donor site	probably null
R5629:Pcnx2	UTSW	8	125898041	missense	probably damaging	1.00
R5630:Pcnx2	UTSW	8	125860958	missense	probably damaging	0.99
R5782:Pcnx2	UTSW	8	125753484	missense	probably damaging	1.00
R5877:Pcnx2	UTSW	8	125753728	missense	probably damaging	0.99
R5879:Pcnx2	UTSW	8	125773946	missense	probably damaging	1.00
R6114:Pcnx2	UTSW	8	125773947	missense	probably damaging	1.00
R6152:Pcnx2	UTSW	8	125753752	missense	probably damaging	0.99
R6154:Pcnx2	UTSW	8	125762813	missense	probably damaging	1.00
R6283:Pcnx2	UTSW	8	125877586	missense	probably damaging	0.99
R6500:Pcnx2	UTSW	8	125753485	missense	probably damaging	1.00
R6629:Pcnx2	UTSW	8	125891112	missense	probably benign	0.00
R6708:Pcnx2	UTSW	8	125860953	critical splice donor site	probably null
R6736:Pcnx2	UTSW	8	125752317	splice site	probably null
R6748:Pcnx2	UTSW	8	125850335	missense	probably damaging	1.00
R6788:Pcnx2	UTSW	8	125772100	missense	probably damaging	1.00
R6849:Pcnx2	UTSW	8	125861210	missense	probably damaging	1.00
R6947:Pcnx2	UTSW	8	125850282	critical splice donor site	probably null
R7100:Pcnx2	UTSW	8	125759114	missense	probably benign	0.16
R7124:Pcnx2	UTSW	8	125753617	missense	probably damaging	0.99
R7130:Pcnx2	UTSW	8	125753584	nonsense	probably null
R7133:Pcnx2	UTSW	8	125801504	missense	probably benign	0.01
R7271:Pcnx2	UTSW	8	125886951	missense	probably benign
R7326:Pcnx2	UTSW	8	125887083	missense	probably damaging	1.00
R7373:Pcnx2	UTSW	8	125808027	missense	probably damaging	1.00
R7397:Pcnx2	UTSW	8	125890885	splice site	probably null
R7662:Pcnx2	UTSW	8	125818771	nonsense	probably null
R7693:Pcnx2	UTSW	8	125887125	missense	probably benign	0.09
R7726:Pcnx2	UTSW	8	125850330	missense	probably benign	0.00
R7745:Pcnx2	UTSW	8	125851107	missense	probably benign	0.04
R7792:Pcnx2	UTSW	8	125892018	missense	possibly damaging	0.63
R7797:Pcnx2	UTSW	8	125785348	missense	possibly damaging	0.70
R7921:Pcnx2	UTSW	8	125837863	missense	probably benign
R7984:Pcnx2	UTSW	8	125759126	missense	probably benign
R8098:Pcnx2	UTSW	8	125768301	missense	probably damaging	1.00
R8277:Pcnx2	UTSW	8	125866016	missense	probably damaging	1.00
R8312:Pcnx2	UTSW	8	125762850	missense	possibly damaging	0.69
R8354:Pcnx2	UTSW	8	125761618	missense	probably damaging	0.99
R8378:Pcnx2	UTSW	8	125760910	missense	probably damaging	1.00
R8713:Pcnx2	UTSW	8	125818786	missense	probably damaging	1.00
R8714:Pcnx2	UTSW	8	125773807	missense	probably benign
R8753:Pcnx2	UTSW	8	125887260	missense	probably benign	0.15
R8790:Pcnx2	UTSW	8	125877567	missense	probably benign
R8925:Pcnx2	UTSW	8	125887920	missense	probably benign	0.01
R8927:Pcnx2	UTSW	8	125887920	missense	probably benign	0.01
R8965:Pcnx2	UTSW	8	125759114	missense	probably benign	0.16
R9006:Pcnx2	UTSW	8	125887257	missense	probably benign	0.00
R9082:Pcnx2	UTSW	8	125887014	missense	probably damaging	1.00
R9202:Pcnx2	UTSW	8	125889677	critical splice acceptor site	probably null
R9315:Pcnx2	UTSW	8	125887380	missense	probably benign	0.00
R9434:Pcnx2	UTSW	8	125815773	missense	probably benign	0.00
R9660:Pcnx2	UTSW	8	125760853	missense	probably damaging	1.00
R9686:Pcnx2	UTSW	8	125866027	missense	probably benign
R9766:Pcnx2	UTSW	8	125761574	missense	probably damaging	1.00
R9778:Pcnx2	UTSW	8	125785437	missense	probably benign	0.00
R9792:Pcnx2	UTSW	8	125808081	missense	probably damaging	0.99
RF018:Pcnx2	UTSW	8	125877519	missense	probably damaging	1.00
Z1088:Pcnx2	UTSW	8	125826928	missense	probably damaging	1.00
Z1088:Pcnx2	UTSW	8	125866018	missense	probably damaging	1.00
Z1176:Pcnx2	UTSW	8	125761654	missense	probably damaging	1.00
Z1176:Pcnx2	UTSW	8	125838014	missense	probably benign	0.30
Z1177:Pcnx2	UTSW	8	125887960	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AACAGTCCCCGAGTCTTTTG -3'
(R):5'- GGGAGTGATGACAACAACCTC -3'

Sequencing Primer
(F):5'- GTCCTCTGCAAGAGTAGTACATGC -3'
(R):5'- GGAGTGATGACAACAACCTCAACTC -3'

Posted On

2019-05-13