Incidental Mutation 'R7034:Ank3'
ID546544
Institutional Source Beutler Lab
Gene Symbol Ank3
Ensembl Gene ENSMUSG00000069601
Gene Nameankyrin 3, epithelial
SynonymsAnkyrin-3, Ankyrin-G, AnkG, Ank-3, 2900054D09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.837) question?
Stock #R7034 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location69398773-70027438 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 69999379 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 680 (T680M)
Ref Sequence ENSEMBL: ENSMUSP00000138623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047061] [ENSMUST00000054167] [ENSMUST00000092431] [ENSMUST00000092432] [ENSMUST00000092433] [ENSMUST00000092434] [ENSMUST00000181974] [ENSMUST00000182029] [ENSMUST00000182155] [ENSMUST00000182207] [ENSMUST00000182269] [ENSMUST00000182437] [ENSMUST00000182439] [ENSMUST00000182884] [ENSMUST00000182692] [ENSMUST00000182795] [ENSMUST00000182972] [ENSMUST00000182992] [ENSMUST00000183023] [ENSMUST00000183074] [ENSMUST00000183148] [ENSMUST00000183169] [ENSMUST00000183261] [ENSMUST00000185582] [ENSMUST00000218680]
Predicted Effect probably damaging
Transcript: ENSMUST00000047061
AA Change: T620M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045834
Gene: ENSMUSG00000069601
AA Change: T620M

DomainStartEndE-ValueType
ZU5 56 160 2.27e-58 SMART
DEATH 541 635 5.8e-33 SMART
low complexity region 676 696 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000054167
AA Change: T1508M

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000061698
Gene: ENSMUSG00000069601
AA Change: T1508M

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 867 884 N/A INTRINSIC
ZU5 944 1048 2.27e-58 SMART
DEATH 1429 1523 5.8e-33 SMART
low complexity region 1760 1780 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092431
AA Change: T1526M

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090087
Gene: ENSMUSG00000069601
AA Change: T1526M

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 885 902 N/A INTRINSIC
ZU5 962 1066 2.27e-58 SMART
DEATH 1447 1541 5.8e-33 SMART
low complexity region 1778 1798 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092432
AA Change: T1529M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000090088
Gene: ENSMUSG00000069601
AA Change: T1529M

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 888 905 N/A INTRINSIC
ZU5 965 1069 2.27e-58 SMART
DEATH 1450 1544 5.8e-33 SMART
low complexity region 1781 1801 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092433
AA Change: T680M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090089
Gene: ENSMUSG00000069601
AA Change: T680M

DomainStartEndE-ValueType
low complexity region 39 56 N/A INTRINSIC
ZU5 116 220 2.27e-58 SMART
DEATH 601 695 5.8e-33 SMART
low complexity region 932 952 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092434
AA Change: T1547M

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090090
Gene: ENSMUSG00000069601
AA Change: T1547M

DomainStartEndE-ValueType
ANK 56 85 6.5e-8 SMART
ANK 89 118 1.1e-8 SMART
ANK 122 151 7.1e-9 SMART
ANK 155 183 4.2e-2 SMART
ANK 184 213 1.7e-1 SMART
ANK 217 246 8.4e-7 SMART
ANK 250 279 3.8e-9 SMART
ANK 283 312 2.1e-6 SMART
ANK 316 345 5.3e-7 SMART
ANK 349 378 9.9e-8 SMART
ANK 382 411 2.5e-9 SMART
ANK 415 444 1.3e-6 SMART
ANK 448 477 6e-8 SMART
ANK 481 510 7.4e-7 SMART
ANK 514 543 1.9e-9 SMART
ANK 547 576 2.2e-8 SMART
ANK 580 609 3e-6 SMART
ANK 613 642 5.4e-8 SMART
ANK 646 675 3.3e-6 SMART
ANK 679 708 4.3e-6 SMART
ANK 712 741 3.9e-8 SMART
ANK 745 774 9.1e-8 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 906 923 N/A INTRINSIC
ZU5 983 1087 1.1e-60 SMART
DEATH 1468 1562 3.8e-35 SMART
low complexity region 1799 1819 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000181974
AA Change: T680M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138285
Gene: ENSMUSG00000069601
AA Change: T680M

DomainStartEndE-ValueType
low complexity region 39 56 N/A INTRINSIC
ZU5 116 220 2.27e-58 SMART
DEATH 601 695 5.8e-33 SMART
low complexity region 736 756 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182029
AA Change: T680M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138337
Gene: ENSMUSG00000069601
AA Change: T680M

DomainStartEndE-ValueType
low complexity region 39 56 N/A INTRINSIC
ZU5 116 220 2.27e-58 SMART
DEATH 601 695 5.8e-33 SMART
low complexity region 932 952 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182155
AA Change: T1508M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138347
Gene: ENSMUSG00000069601
AA Change: T1508M

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 867 884 N/A INTRINSIC
ZU5 944 1048 2.27e-58 SMART
DEATH 1429 1523 5.8e-33 SMART
low complexity region 1564 1584 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182207
AA Change: T138M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138531
Gene: ENSMUSG00000069601
AA Change: T138M

DomainStartEndE-ValueType
DEATH 59 153 5.8e-33 SMART
low complexity region 297 317 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182269
AA Change: T667M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138123
Gene: ENSMUSG00000069601
AA Change: T667M

DomainStartEndE-ValueType
ZU5 115 219 2.27e-58 SMART
DEATH 588 682 7.66e-33 SMART
low complexity region 723 743 N/A INTRINSIC
low complexity region 886 895 N/A INTRINSIC
low complexity region 897 909 N/A INTRINSIC
low complexity region 935 947 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182437
AA Change: T667M

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138586
Gene: ENSMUSG00000069601
AA Change: T667M

DomainStartEndE-ValueType
ZU5 115 219 2.27e-58 SMART
DEATH 588 682 7.66e-33 SMART
low complexity region 723 743 N/A INTRINSIC
low complexity region 869 878 N/A INTRINSIC
low complexity region 880 892 N/A INTRINSIC
low complexity region 918 930 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182439
AA Change: T620M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138356
Gene: ENSMUSG00000069601
AA Change: T620M

DomainStartEndE-ValueType
ZU5 56 160 2.27e-58 SMART
DEATH 541 635 5.8e-33 SMART
low complexity region 676 696 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182884
AA Change: T1547M

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138326
Gene: ENSMUSG00000069601
AA Change: T1547M

DomainStartEndE-ValueType
ANK 56 85 6.4e-8 SMART
ANK 89 118 1.1e-8 SMART
ANK 122 151 7e-9 SMART
ANK 155 183 4.1e-2 SMART
ANK 184 213 1.7e-1 SMART
ANK 217 246 8.2e-7 SMART
ANK 250 279 3.7e-9 SMART
ANK 283 312 2.1e-6 SMART
ANK 316 345 5.2e-7 SMART
ANK 349 378 9.7e-8 SMART
ANK 382 411 2.4e-9 SMART
ANK 415 444 1.3e-6 SMART
ANK 448 477 5.9e-8 SMART
ANK 481 510 7.3e-7 SMART
ANK 514 543 1.9e-9 SMART
ANK 547 576 2.1e-8 SMART
ANK 580 609 2.9e-6 SMART
ANK 613 642 5.3e-8 SMART
ANK 646 675 3.2e-6 SMART
ANK 679 708 4.2e-6 SMART
ANK 712 741 3.9e-8 SMART
ANK 745 774 8.9e-8 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 906 923 N/A INTRINSIC
ZU5 983 1087 1.1e-60 SMART
DEATH 1468 1562 3.7e-35 SMART
low complexity region 1799 1819 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182665
Predicted Effect probably damaging
Transcript: ENSMUST00000182692
AA Change: T680M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138623
Gene: ENSMUSG00000069601
AA Change: T680M

DomainStartEndE-ValueType
low complexity region 39 56 N/A INTRINSIC
ZU5 116 220 2.27e-58 SMART
DEATH 601 695 5.8e-33 SMART
low complexity region 839 859 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182795
AA Change: T663M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138413
Gene: ENSMUSG00000069601
AA Change: T663M

DomainStartEndE-ValueType
ZU5 111 215 2.27e-58 SMART
DEATH 584 678 7.66e-33 SMART
low complexity region 719 739 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182972
AA Change: T767M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138481
Gene: ENSMUSG00000069601
AA Change: T767M

DomainStartEndE-ValueType
ANK 4 33 1.43e-5 SMART
low complexity region 61 72 N/A INTRINSIC
low complexity region 126 143 N/A INTRINSIC
ZU5 203 307 2.27e-58 SMART
DEATH 688 782 5.8e-33 SMART
low complexity region 1019 1039 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182992
AA Change: T2404M

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000138686
Gene: ENSMUSG00000069601
AA Change: T2404M

DomainStartEndE-ValueType
coiled coil region 4 38 N/A INTRINSIC
ANK 73 102 1.01e-5 SMART
ANK 106 135 1.66e-6 SMART
ANK 139 168 1.1e-6 SMART
ANK 172 200 6.51e0 SMART
ANK 201 230 2.6e1 SMART
ANK 242 271 1.31e-4 SMART
ANK 275 304 5.88e-7 SMART
ANK 308 337 3.23e-4 SMART
ANK 341 370 8.07e-5 SMART
ANK 374 403 1.53e-5 SMART
ANK 407 436 3.88e-7 SMART
ANK 440 469 1.99e-4 SMART
ANK 473 502 9.41e-6 SMART
ANK 506 535 1.14e-4 SMART
ANK 539 568 2.94e-7 SMART
ANK 572 601 3.33e-6 SMART
ANK 605 634 4.56e-4 SMART
ANK 638 667 8.19e-6 SMART
ANK 671 700 5.24e-4 SMART
ANK 704 733 6.46e-4 SMART
ANK 737 766 6.21e-6 SMART
ANK 770 799 1.43e-5 SMART
low complexity region 827 838 N/A INTRINSIC
low complexity region 913 930 N/A INTRINSIC
ZU5 990 1094 2.27e-58 SMART
low complexity region 1515 1536 N/A INTRINSIC
low complexity region 1745 1762 N/A INTRINSIC
low complexity region 1805 1827 N/A INTRINSIC
low complexity region 1876 1897 N/A INTRINSIC
low complexity region 1969 1984 N/A INTRINSIC
DEATH 2325 2419 7.66e-33 SMART
low complexity region 2460 2480 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000183023
AA Change: T339M
SMART Domains Protein: ENSMUSP00000138450
Gene: ENSMUSG00000069601
AA Change: T339M

DomainStartEndE-ValueType
DEATH 260 354 7.66e-33 SMART
low complexity region 395 415 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183074
AA Change: T667M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138671
Gene: ENSMUSG00000069601
AA Change: T667M

DomainStartEndE-ValueType
ZU5 115 219 2.27e-58 SMART
DEATH 588 682 7.66e-33 SMART
low complexity region 919 939 N/A INTRINSIC
low complexity region 1065 1074 N/A INTRINSIC
low complexity region 1076 1088 N/A INTRINSIC
low complexity region 1114 1126 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183148
AA Change: T1495M

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138770
Gene: ENSMUSG00000069601
AA Change: T1495M

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
ZU5 943 1047 2.27e-58 SMART
DEATH 1416 1510 7.66e-33 SMART
low complexity region 1747 1767 N/A INTRINSIC
low complexity region 1893 1902 N/A INTRINSIC
low complexity region 1904 1916 N/A INTRINSIC
low complexity region 1942 1954 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000183169
AA Change: T1495M

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138348
Gene: ENSMUSG00000069601
AA Change: T1495M

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
ZU5 943 1047 2.27e-58 SMART
DEATH 1416 1510 7.66e-33 SMART
low complexity region 1551 1571 N/A INTRINSIC
low complexity region 1715 1724 N/A INTRINSIC
low complexity region 1726 1738 N/A INTRINSIC
low complexity region 1764 1776 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183261
AA Change: T667M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138095
Gene: ENSMUSG00000069601
AA Change: T667M

DomainStartEndE-ValueType
ZU5 115 219 2.27e-58 SMART
DEATH 588 682 7.66e-33 SMART
low complexity region 919 939 N/A INTRINSIC
low complexity region 1082 1091 N/A INTRINSIC
low complexity region 1093 1105 N/A INTRINSIC
low complexity region 1131 1143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185582
SMART Domains Protein: ENSMUSP00000140724
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
low complexity region 66 94 N/A INTRINSIC
Pfam:Death 138 178 7.4e-7 PFAM
Predicted Effect
Predicted Effect possibly damaging
Transcript: ENSMUST00000218680
AA Change: T1540M

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the ankyrin protein family. Ankyrins link integral membrane proteins to the spectrin-based cytoskeleton. Ankyrin family members share a protein structure which includes three independently folded domains: the N-terminal ankyrin repeat domain, the central spectrin-binding domain, and the C-terminal rod domain. This ankyrin functions as the major ankyrin in the kidney and may play a role in the polarized distribution of many integral membrane proteins to specific subcellular sites. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a mutation that selectively ablates gene expression in brain exhibit progressive ataxia, tremors, and a substantially reduced cerebellum deficient in Purkinje cells. Mutants are poor breeders and die by 4-6 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,609,256 probably null Het
9030624J02Rik T C 7: 118,773,092 S290P probably damaging Het
9130011E15Rik A G 19: 45,965,249 I195T probably damaging Het
Adamts1 T A 16: 85,802,746 probably benign Het
Aff4 A G 11: 53,408,409 K979E probably damaging Het
Aftph A T 11: 20,692,498 M845K probably damaging Het
Akt2 T C 7: 27,637,012 probably null Het
Aldh1a7 A T 19: 20,708,178 L336Q possibly damaging Het
Apeh T C 9: 108,094,271 E59G possibly damaging Het
Armc8 C T 9: 99,483,965 probably null Het
Atp2b1 C T 10: 98,987,310 T244I probably damaging Het
Btaf1 C A 19: 37,004,469 T1633K probably benign Het
Cacng8 A G 7: 3,415,303 S324G probably benign Het
Calcr T A 6: 3,692,543 Q400L probably damaging Het
Caprin2 G A 6: 148,848,205 P536S possibly damaging Het
Ccdc54 A T 16: 50,590,588 M105K probably benign Het
Ccna1 T C 3: 55,046,039 E381G possibly damaging Het
Cd2ap A T 17: 42,798,599 L623Q probably damaging Het
Cdkl3 A G 11: 52,027,215 E415G probably benign Het
Chd5 C A 4: 152,360,941 L430I possibly damaging Het
Clspn G A 4: 126,580,982 E975K possibly damaging Het
Cobl C A 11: 12,254,177 V835F probably damaging Het
D430041D05Rik C A 2: 104,192,538 R1037L probably damaging Het
Derl1 A G 15: 57,879,047 probably null Het
Dhrs9 T G 2: 69,393,176 N89K probably benign Het
Erich1 A G 8: 14,064,330 I60T probably benign Het
Fam126b T A 1: 58,535,537 M282L probably benign Het
Fam155a G A 8: 9,770,589 P144S possibly damaging Het
Fam184a A T 10: 53,694,814 S408T possibly damaging Het
Fcgr4 T A 1: 171,020,088 M85K probably benign Het
Foxj3 A G 4: 119,619,300 E259G probably damaging Het
Galnt11 T C 5: 25,258,813 I361T probably damaging Het
Gck A G 11: 5,901,747 S441P probably damaging Het
Gdap1l1 G T 2: 163,446,145 V98F probably damaging Het
Gm13089 A T 4: 143,697,328 I297N probably damaging Het
Gm884 T A 11: 103,615,812 probably benign Het
Gramd1a A G 7: 31,132,756 probably null Het
Herc3 A T 6: 58,876,855 M629L probably benign Het
Hist2h2ab C T 3: 96,219,988 Q25* probably null Het
Hoxc12 G A 15: 102,938,360 G229D probably damaging Het
Itga9 T C 9: 118,698,365 L528P probably benign Het
Krt39 A C 11: 99,521,236 V8G probably benign Het
Krt71 A G 15: 101,738,337 I312T probably benign Het
Mllt11 A G 3: 95,220,433 Y9H probably damaging Het
Mrgpra3 G T 7: 47,590,090 N29K possibly damaging Het
Mug1 A G 6: 121,873,644 T700A probably benign Het
Myl1 T C 1: 66,930,236 N79S probably damaging Het
Myo18b G A 5: 112,723,904 Q2104* probably null Het
Ndufs2 T C 1: 171,238,308 D256G probably benign Het
Nek5 T C 8: 22,107,723 N280S probably benign Het
Nwd2 A T 5: 63,804,915 N614I probably damaging Het
Olfr794 G A 10: 129,571,072 C139Y possibly damaging Het
Parp1 G T 1: 180,598,252 K849N possibly damaging Het
Pcnx2 T C 8: 125,785,302 T1422A probably damaging Het
Plce1 A G 19: 38,739,357 N1520S probably damaging Het
Ppcdc T C 9: 57,415,170 T149A probably damaging Het
Ppl A G 16: 5,087,502 V1643A probably benign Het
Prrx1 T A 1: 163,248,338 M220L probably benign Het
Pspc1 A C 14: 56,758,628 probably null Het
Ptpn20 A G 14: 33,614,435 *44W probably null Het
Qars T A 9: 108,514,777 V83E probably damaging Het
Rbm33 T C 5: 28,394,498 M956T unknown Het
Sash1 C A 10: 8,730,083 E848* probably null Het
Scai T A 2: 39,121,135 Y163F probably damaging Het
Serpinf2 A T 11: 75,438,418 probably benign Het
Sgo2b T A 8: 63,926,834 H988L probably benign Het
Sh2b2 G A 5: 136,218,885 T604I probably benign Het
Skint4 A T 4: 112,158,084 I449F possibly damaging Het
Slc30a2 A G 4: 134,347,342 I88V possibly damaging Het
Smug1 A G 15: 103,155,942 L184P probably damaging Het
Spatc1 A G 15: 76,283,880 T180A probably benign Het
Ssr1 A T 13: 37,994,025 L20Q probably null Het
Supt4a A G 11: 87,743,258 E100G probably damaging Het
Teddm2 T C 1: 153,850,574 I132V probably benign Het
Tmem131 C T 1: 36,792,973 G1861E possibly damaging Het
Tpr A T 1: 150,423,607 H1186L probably benign Het
Trim34b A T 7: 104,329,536 probably benign Het
Trpm2 T C 10: 77,912,592 M1415V probably benign Het
Ttll12 A G 15: 83,586,885 F264S probably benign Het
Vmn2r59 T C 7: 42,046,220 E256G probably benign Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Wdfy3 G A 5: 101,907,518 T1562I probably damaging Het
Ybey T C 10: 76,468,363 S2G possibly damaging Het
Zfp346 A T 13: 55,132,387 Q308L probably benign Het
Other mutations in Ank3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Ank3 APN 10 69982205 splice site probably benign
IGL00578:Ank3 APN 10 70002394 missense possibly damaging 0.95
IGL00851:Ank3 APN 10 69874833 missense probably damaging 0.99
IGL01067:Ank3 APN 10 69850196 missense probably damaging 1.00
IGL01483:Ank3 APN 10 69874809 missense probably damaging 1.00
IGL01549:Ank3 APN 10 69932420 missense probably damaging 1.00
IGL01576:Ank3 APN 10 69980291 missense probably damaging 1.00
IGL01601:Ank3 APN 10 70004725 missense possibly damaging 0.87
IGL02047:Ank3 APN 10 69892494 missense possibly damaging 0.94
IGL02088:Ank3 APN 10 69999373 missense probably damaging 1.00
IGL02159:Ank3 APN 10 69808892 missense probably damaging 1.00
IGL02249:Ank3 APN 10 69882370 missense probably damaging 1.00
IGL02942:Ank3 APN 10 69973877 missense probably damaging 1.00
IGL02979:Ank3 APN 10 70002099 missense probably benign 0.01
IGL03379:Ank3 APN 10 69973772 missense probably damaging 1.00
PIT4495001:Ank3 UTSW 10 69993072 missense
R0011:Ank3 UTSW 10 69979451 splice site probably benign
R0011:Ank3 UTSW 10 69979451 splice site probably benign
R0172:Ank3 UTSW 10 69976058 missense probably damaging 1.00
R0315:Ank3 UTSW 10 70002517 missense probably damaging 0.98
R0480:Ank3 UTSW 10 69879926 missense probably damaging 0.96
R0485:Ank3 UTSW 10 69882544 missense possibly damaging 0.89
R0511:Ank3 UTSW 10 69882368 missense probably damaging 1.00
R1148:Ank3 UTSW 10 69882539 missense probably damaging 1.00
R1148:Ank3 UTSW 10 69882539 missense probably damaging 1.00
R1165:Ank3 UTSW 10 69898302 missense possibly damaging 0.90
R1186:Ank3 UTSW 10 69867460 missense probably damaging 1.00
R1257:Ank3 UTSW 10 69874835 nonsense probably null
R1300:Ank3 UTSW 10 70004665 missense probably benign 0.03
R1391:Ank3 UTSW 10 69534280 missense possibly damaging 0.96
R1549:Ank3 UTSW 10 70001982 missense probably benign 0.18
R1586:Ank3 UTSW 10 69877878 missense probably damaging 0.98
R1619:Ank3 UTSW 10 69879975 missense probably damaging 1.00
R1643:Ank3 UTSW 10 69884802 missense probably benign 0.00
R1874:Ank3 UTSW 10 69898083 missense probably damaging 1.00
R1884:Ank3 UTSW 10 70015592 missense possibly damaging 0.53
R1901:Ank3 UTSW 10 69822337 missense probably damaging 1.00
R1986:Ank3 UTSW 10 69867428 missense probably damaging 1.00
R2051:Ank3 UTSW 10 69898090 missense probably damaging 0.97
R2273:Ank3 UTSW 10 69950942 splice site probably null
R2274:Ank3 UTSW 10 69950942 splice site probably null
R2421:Ank3 UTSW 10 69982204 splice site probably benign
R2434:Ank3 UTSW 10 70002118 missense probably damaging 1.00
R2969:Ank3 UTSW 10 69994395 missense probably damaging 1.00
R3426:Ank3 UTSW 10 69706894 missense probably benign
R3885:Ank3 UTSW 10 69899036 missense probably damaging 1.00
R3936:Ank3 UTSW 10 69879989 nonsense probably null
R4258:Ank3 UTSW 10 70004762 missense probably benign 0.33
R4320:Ank3 UTSW 10 69904246 missense possibly damaging 0.70
R4434:Ank3 UTSW 10 69987070 missense probably damaging 0.99
R4435:Ank3 UTSW 10 69987070 missense probably damaging 0.99
R4486:Ank3 UTSW 10 70001974 missense possibly damaging 0.86
R4489:Ank3 UTSW 10 69898256 missense probably damaging 1.00
R4492:Ank3 UTSW 10 69808925 missense probably damaging 1.00
R4508:Ank3 UTSW 10 69892370 missense probably damaging 1.00
R4561:Ank3 UTSW 10 70002018 missense probably damaging 0.99
R4724:Ank3 UTSW 10 69706858 missense probably benign
R4751:Ank3 UTSW 10 69986206 missense probably benign 0.19
R4790:Ank3 UTSW 10 69988151 nonsense probably null
R4795:Ank3 UTSW 10 69858265 missense probably benign 0.36
R4921:Ank3 UTSW 10 70002109 missense probably damaging 1.00
R4932:Ank3 UTSW 10 69898223 splice site probably null
R4935:Ank3 UTSW 10 69976203 missense probably damaging 0.99
R4946:Ank3 UTSW 10 69898117 missense probably damaging 1.00
R5174:Ank3 UTSW 10 69892379 missense probably damaging 0.99
R5208:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5248:Ank3 UTSW 10 69987108 missense probably benign 0.00
R5255:Ank3 UTSW 10 69885200 missense probably damaging 1.00
R5307:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5308:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5373:Ank3 UTSW 10 69953476 splice site probably null
R5374:Ank3 UTSW 10 69953476 splice site probably null
R5502:Ank3 UTSW 10 69920461 missense probably benign 0.12
R5508:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5509:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5510:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5538:Ank3 UTSW 10 69987427 missense probably damaging 1.00
R5664:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5665:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5682:Ank3 UTSW 10 69893517 missense probably damaging 1.00
R5834:Ank3 UTSW 10 69822257 missense probably damaging 1.00
R5881:Ank3 UTSW 10 69986830 missense probably benign 0.31
R5914:Ank3 UTSW 10 69992944 intron probably benign
R5940:Ank3 UTSW 10 69920486 missense probably benign 0.00
R5952:Ank3 UTSW 10 69986463 missense probably benign 0.07
R5963:Ank3 UTSW 10 69987226 nonsense probably null
R6075:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6076:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6077:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6081:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6092:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6118:Ank3 UTSW 10 69994401 missense probably damaging 0.98
R6135:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6175:Ank3 UTSW 10 69927727 missense probably damaging 1.00
R6248:Ank3 UTSW 10 69973850 missense probably benign 0.10
R6249:Ank3 UTSW 10 69823076 critical splice acceptor site probably null
R6273:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6274:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6290:Ank3 UTSW 10 69991368 intron probably benign
R6298:Ank3 UTSW 10 69850176 missense probably damaging 1.00
R6349:Ank3 UTSW 10 69979439 missense probably damaging 1.00
R6366:Ank3 UTSW 10 69999358 missense probably damaging 1.00
R6371:Ank3 UTSW 10 69808879 missense probably damaging 1.00
R6459:Ank3 UTSW 10 69991747 intron probably benign
R6489:Ank3 UTSW 10 69991629 missense probably benign 0.00
R6491:Ank3 UTSW 10 69991629 missense probably benign 0.00
R6499:Ank3 UTSW 10 69991744 intron probably benign
R6520:Ank3 UTSW 10 69988387 missense probably damaging 1.00
R6521:Ank3 UTSW 10 69992766 intron probably benign
R6535:Ank3 UTSW 10 69877854 missense probably damaging 1.00
R6548:Ank3 UTSW 10 69892410 missense probably damaging 1.00
R6587:Ank3 UTSW 10 69990152 intron probably benign
R6624:Ank3 UTSW 10 69904468 missense possibly damaging 0.66
R6722:Ank3 UTSW 10 69990244 intron probably benign
R6729:Ank3 UTSW 10 69808925 missense probably damaging 1.00
R6731:Ank3 UTSW 10 70014028 missense possibly damaging 0.70
R6742:Ank3 UTSW 10 69991582 intron probably benign
R6788:Ank3 UTSW 10 70004723 missense probably damaging 1.00
R6846:Ank3 UTSW 10 69824349 missense probably damaging 1.00
R6933:Ank3 UTSW 10 69904212 missense probably damaging 1.00
R7036:Ank3 UTSW 10 69999379 missense probably damaging 1.00
R7132:Ank3 UTSW 10 69989914 missense
R7171:Ank3 UTSW 10 69992481 missense
R7241:Ank3 UTSW 10 69706814 start codon destroyed probably null 0.11
R7386:Ank3 UTSW 10 69822249 missense unknown
R7445:Ank3 UTSW 10 69992124 missense
R7452:Ank3 UTSW 10 69899051 missense possibly damaging 0.53
R7492:Ank3 UTSW 10 69882527 missense unknown
R7494:Ank3 UTSW 10 69988926 missense
R7512:Ank3 UTSW 10 69990861 missense
R7543:Ank3 UTSW 10 69951016 missense possibly damaging 0.96
R7577:Ank3 UTSW 10 69992572 missense
R7610:Ank3 UTSW 10 69986422 missense
R7673:Ank3 UTSW 10 69990501 missense
R7682:Ank3 UTSW 10 69988235 missense possibly damaging 0.53
R7814:Ank3 UTSW 10 69986904 missense
R7835:Ank3 UTSW 10 69987727 missense
R7843:Ank3 UTSW 10 69986958 missense probably benign 0.01
R7891:Ank3 UTSW 10 69988309 missense probably damaging 1.00
R8109:Ank3 UTSW 10 69990318 missense
R8175:Ank3 UTSW 10 69893509 missense unknown
R8210:Ank3 UTSW 10 69976095 missense possibly damaging 0.72
R8211:Ank3 UTSW 10 69867398 missense unknown
R8299:Ank3 UTSW 10 69976151 missense probably damaging 0.98
R8302:Ank3 UTSW 10 70004980 missense possibly damaging 0.73
R8516:Ank3 UTSW 10 69927729 nonsense probably null
R8543:Ank3 UTSW 10 70002436 missense probably damaging 1.00
R8549:Ank3 UTSW 10 69982182 missense possibly damaging 0.74
Z1176:Ank3 UTSW 10 69932474 missense possibly damaging 0.96
Z1176:Ank3 UTSW 10 69951010 missense possibly damaging 0.85
Z1176:Ank3 UTSW 10 69991215 missense
Predicted Primers PCR Primer
(F):5'- ATCTGTGATCTGCTCGAGCC -3'
(R):5'- AATCACAGTGCCCGTGGTAG -3'

Sequencing Primer
(F):5'- TCGAGCCGAGCAGCAGTAAG -3'
(R):5'- TTGCCTCGTCCGACAGTG -3'
Posted On2019-05-13