Incidental Mutation 'R7034:Trpm2'
ID 546546
Institutional Source Beutler Lab
Gene Symbol Trpm2
Ensembl Gene ENSMUSG00000009292
Gene Name transient receptor potential cation channel, subfamily M, member 2
Synonyms Trrp7, TRPC7, LTRPC2, 9830168K16Rik
MMRRC Submission 045135-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.169) question?
Stock # R7034 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 77743556-77805746 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 77748426 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 1415 (M1415V)
Ref Sequence ENSEMBL: ENSMUSP00000101040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105401]
AlphaFold Q91YD4
Predicted Effect probably benign
Transcript: ENSMUST00000105401
AA Change: M1415V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: M1415V

DomainStartEndE-ValueType
low complexity region 654 672 N/A INTRINSIC
transmembrane domain 750 772 N/A INTRINSIC
Pfam:Ion_trans 794 1057 3.7e-21 PFAM
low complexity region 1078 1090 N/A INTRINSIC
low complexity region 1106 1115 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
PDB:1QVJ|A 1236 1506 3e-37 PDB
SCOP:d1k2ea_ 1369 1502 9e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,445,118 (GRCm39) probably null Het
Adamts1 T A 16: 85,599,634 (GRCm39) probably benign Het
Aff4 A G 11: 53,299,236 (GRCm39) K979E probably damaging Het
Aftph A T 11: 20,642,498 (GRCm39) M845K probably damaging Het
Akt2 T C 7: 27,336,437 (GRCm39) probably null Het
Aldh1a7 A T 19: 20,685,542 (GRCm39) L336Q possibly damaging Het
Ank3 C T 10: 69,835,209 (GRCm39) T680M probably damaging Het
Apeh T C 9: 107,971,470 (GRCm39) E59G possibly damaging Het
Armc8 C T 9: 99,366,018 (GRCm39) probably null Het
Armh3 A G 19: 45,953,688 (GRCm39) I195T probably damaging Het
Atp2b1 C T 10: 98,823,172 (GRCm39) T244I probably damaging Het
Btaf1 C A 19: 36,981,869 (GRCm39) T1633K probably benign Het
Cacng8 A G 7: 3,463,819 (GRCm39) S324G probably benign Het
Calcr T A 6: 3,692,543 (GRCm39) Q400L probably damaging Het
Caprin2 G A 6: 148,749,703 (GRCm39) P536S possibly damaging Het
Ccdc54 A T 16: 50,410,951 (GRCm39) M105K probably benign Het
Ccna1 T C 3: 54,953,460 (GRCm39) E381G possibly damaging Het
Cd2ap A T 17: 43,109,490 (GRCm39) L623Q probably damaging Het
Cdkl3 A G 11: 51,918,042 (GRCm39) E415G probably benign Het
Chd5 C A 4: 152,445,398 (GRCm39) L430I possibly damaging Het
Clspn G A 4: 126,474,775 (GRCm39) E975K possibly damaging Het
Cobl C A 11: 12,204,177 (GRCm39) V835F probably damaging Het
D430041D05Rik C A 2: 104,022,883 (GRCm39) R1037L probably damaging Het
Derl1 A G 15: 57,742,443 (GRCm39) probably null Het
Dhrs9 T G 2: 69,223,520 (GRCm39) N89K probably benign Het
Erich1 A G 8: 14,114,330 (GRCm39) I60T probably benign Het
Fam184a A T 10: 53,570,910 (GRCm39) S408T possibly damaging Het
Fcgr4 T A 1: 170,847,657 (GRCm39) M85K probably benign Het
Foxj3 A G 4: 119,476,497 (GRCm39) E259G probably damaging Het
Galnt11 T C 5: 25,463,811 (GRCm39) I361T probably damaging Het
Gck A G 11: 5,851,747 (GRCm39) S441P probably damaging Het
Gdap1l1 G T 2: 163,288,065 (GRCm39) V98F probably damaging Het
Gramd1a A G 7: 30,832,181 (GRCm39) probably null Het
H2ac21 C T 3: 96,127,304 (GRCm39) Q25* probably null Het
Herc3 A T 6: 58,853,840 (GRCm39) M629L probably benign Het
Hoxc12 G A 15: 102,846,795 (GRCm39) G229D probably damaging Het
Hycc2 T A 1: 58,574,696 (GRCm39) M282L probably benign Het
Itga9 T C 9: 118,527,433 (GRCm39) L528P probably benign Het
Krt39 A C 11: 99,412,062 (GRCm39) V8G probably benign Het
Krt71 A G 15: 101,646,772 (GRCm39) I312T probably benign Het
Lrrc37 T A 11: 103,506,638 (GRCm39) probably benign Het
Mllt11 A G 3: 95,127,744 (GRCm39) Y9H probably damaging Het
Mrgpra3 G T 7: 47,239,838 (GRCm39) N29K possibly damaging Het
Mug1 A G 6: 121,850,603 (GRCm39) T700A probably benign Het
Myl1 T C 1: 66,969,395 (GRCm39) N79S probably damaging Het
Myo18b G A 5: 112,871,770 (GRCm39) Q2104* probably null Het
Nalf1 G A 8: 9,820,589 (GRCm39) P144S possibly damaging Het
Ndufs2 T C 1: 171,065,877 (GRCm39) D256G probably benign Het
Nek5 T C 8: 22,597,739 (GRCm39) N280S probably benign Het
Nwd2 A T 5: 63,962,258 (GRCm39) N614I probably damaging Het
Or6c88 G A 10: 129,406,941 (GRCm39) C139Y possibly damaging Het
Parp1 G T 1: 180,425,817 (GRCm39) K849N possibly damaging Het
Pcnx2 T C 8: 126,512,041 (GRCm39) T1422A probably damaging Het
Plce1 A G 19: 38,727,801 (GRCm39) N1520S probably damaging Het
Ppcdc T C 9: 57,322,453 (GRCm39) T149A probably damaging Het
Ppl A G 16: 4,905,366 (GRCm39) V1643A probably benign Het
Pramel23 A T 4: 143,423,898 (GRCm39) I297N probably damaging Het
Prrx1 T A 1: 163,075,907 (GRCm39) M220L probably benign Het
Pspc1 A C 14: 56,996,085 (GRCm39) probably null Het
Ptpn20 A G 14: 33,336,392 (GRCm39) *44W probably null Het
Qars1 T A 9: 108,391,976 (GRCm39) V83E probably damaging Het
Rbm33 T C 5: 28,599,496 (GRCm39) M956T unknown Het
Sash1 C A 10: 8,605,847 (GRCm39) E848* probably null Het
Scai T A 2: 39,011,147 (GRCm39) Y163F probably damaging Het
Serpinf2 A T 11: 75,329,244 (GRCm39) probably benign Het
Sgo2b T A 8: 64,379,868 (GRCm39) H988L probably benign Het
Sh2b2 G A 5: 136,247,739 (GRCm39) T604I probably benign Het
Skint4 A T 4: 112,015,281 (GRCm39) I449F possibly damaging Het
Slc30a2 A G 4: 134,074,653 (GRCm39) I88V possibly damaging Het
Smug1 A G 15: 103,064,369 (GRCm39) L184P probably damaging Het
Spatc1 A G 15: 76,168,080 (GRCm39) T180A probably benign Het
Ssr1 A T 13: 38,178,001 (GRCm39) L20Q probably null Het
Supt4a A G 11: 87,634,084 (GRCm39) E100G probably damaging Het
Teddm2 T C 1: 153,726,320 (GRCm39) I132V probably benign Het
Tmem131 C T 1: 36,832,054 (GRCm39) G1861E possibly damaging Het
Tpr A T 1: 150,299,358 (GRCm39) H1186L probably benign Het
Trim34b A T 7: 103,978,743 (GRCm39) probably benign Het
Ttll12 A G 15: 83,471,086 (GRCm39) F264S probably benign Het
Vmn2r59 T C 7: 41,695,644 (GRCm39) E256G probably benign Het
Vmn2r93 A T 17: 18,546,672 (GRCm39) H848L probably benign Het
Vps35l T C 7: 118,372,315 (GRCm39) S290P probably damaging Het
Wdfy3 G A 5: 102,055,384 (GRCm39) T1562I probably damaging Het
Ybey T C 10: 76,304,197 (GRCm39) S2G possibly damaging Het
Zfp346 A T 13: 55,280,200 (GRCm39) Q308L probably benign Het
Other mutations in Trpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Trpm2 APN 10 77,778,749 (GRCm39) splice site probably null
IGL00773:Trpm2 APN 10 77,785,048 (GRCm39) nonsense probably null
IGL00962:Trpm2 APN 10 77,779,750 (GRCm39) splice site probably benign
IGL01093:Trpm2 APN 10 77,768,114 (GRCm39) missense probably benign 0.04
IGL01124:Trpm2 APN 10 77,781,659 (GRCm39) splice site probably benign
IGL01301:Trpm2 APN 10 77,759,818 (GRCm39) missense probably damaging 1.00
IGL02094:Trpm2 APN 10 77,778,830 (GRCm39) nonsense probably null
IGL02175:Trpm2 APN 10 77,773,741 (GRCm39) missense probably benign 0.07
IGL02653:Trpm2 APN 10 77,748,503 (GRCm39) missense probably benign 0.19
IGL02667:Trpm2 APN 10 77,771,776 (GRCm39) missense probably damaging 1.00
IGL02668:Trpm2 APN 10 77,771,776 (GRCm39) missense probably damaging 1.00
IGL02828:Trpm2 APN 10 77,754,820 (GRCm39) missense probably benign 0.16
IGL02951:Trpm2 APN 10 77,765,112 (GRCm39) missense possibly damaging 0.95
IGL03188:Trpm2 APN 10 77,754,743 (GRCm39) missense probably benign 0.18
IGL03242:Trpm2 APN 10 77,753,568 (GRCm39) missense probably benign
IGL03405:Trpm2 APN 10 77,801,906 (GRCm39) splice site probably benign
Fugit UTSW 10 77,774,202 (GRCm39) missense probably damaging 1.00
scusate UTSW 10 77,802,828 (GRCm39) nonsense probably null
temporal UTSW 10 77,761,516 (GRCm39) missense probably benign 0.30
ANU18:Trpm2 UTSW 10 77,759,818 (GRCm39) missense probably damaging 1.00
R0147:Trpm2 UTSW 10 77,761,659 (GRCm39) missense probably damaging 1.00
R0148:Trpm2 UTSW 10 77,761,659 (GRCm39) missense probably damaging 1.00
R0302:Trpm2 UTSW 10 77,779,824 (GRCm39) splice site probably benign
R0332:Trpm2 UTSW 10 77,783,822 (GRCm39) missense probably damaging 1.00
R0586:Trpm2 UTSW 10 77,759,350 (GRCm39) missense probably damaging 0.99
R0847:Trpm2 UTSW 10 77,765,122 (GRCm39) missense possibly damaging 0.94
R1183:Trpm2 UTSW 10 77,759,398 (GRCm39) missense probably damaging 1.00
R1472:Trpm2 UTSW 10 77,801,841 (GRCm39) missense probably damaging 1.00
R1510:Trpm2 UTSW 10 77,802,828 (GRCm39) nonsense probably null
R1518:Trpm2 UTSW 10 77,778,839 (GRCm39) missense possibly damaging 0.67
R1564:Trpm2 UTSW 10 77,778,833 (GRCm39) missense probably benign 0.14
R1593:Trpm2 UTSW 10 77,778,910 (GRCm39) missense possibly damaging 0.71
R1617:Trpm2 UTSW 10 77,771,709 (GRCm39) splice site probably null
R1673:Trpm2 UTSW 10 77,778,778 (GRCm39) missense probably benign
R1912:Trpm2 UTSW 10 77,781,710 (GRCm39) missense probably benign 0.10
R1932:Trpm2 UTSW 10 77,776,992 (GRCm39) missense probably damaging 1.00
R1993:Trpm2 UTSW 10 77,783,823 (GRCm39) missense probably damaging 1.00
R2013:Trpm2 UTSW 10 77,761,600 (GRCm39) missense probably damaging 1.00
R2151:Trpm2 UTSW 10 77,768,013 (GRCm39) missense probably benign 0.01
R2201:Trpm2 UTSW 10 77,756,305 (GRCm39) nonsense probably null
R2217:Trpm2 UTSW 10 77,777,016 (GRCm39) missense probably damaging 1.00
R2312:Trpm2 UTSW 10 77,754,798 (GRCm39) missense probably benign 0.04
R2339:Trpm2 UTSW 10 77,750,640 (GRCm39) splice site probably benign
R2395:Trpm2 UTSW 10 77,783,714 (GRCm39) missense possibly damaging 0.69
R2396:Trpm2 UTSW 10 77,766,471 (GRCm39) missense probably benign 0.14
R2405:Trpm2 UTSW 10 77,770,558 (GRCm39) missense probably damaging 1.00
R2567:Trpm2 UTSW 10 77,777,008 (GRCm39) missense probably damaging 0.99
R3001:Trpm2 UTSW 10 77,766,368 (GRCm39) critical splice donor site probably null
R3002:Trpm2 UTSW 10 77,766,368 (GRCm39) critical splice donor site probably null
R3125:Trpm2 UTSW 10 77,747,208 (GRCm39) missense probably damaging 1.00
R3500:Trpm2 UTSW 10 77,768,136 (GRCm39) missense probably benign 0.03
R3777:Trpm2 UTSW 10 77,771,824 (GRCm39) missense probably benign 0.13
R3778:Trpm2 UTSW 10 77,771,824 (GRCm39) missense probably benign 0.13
R4272:Trpm2 UTSW 10 77,769,476 (GRCm39) missense probably damaging 1.00
R4384:Trpm2 UTSW 10 77,753,559 (GRCm39) missense probably benign 0.44
R4395:Trpm2 UTSW 10 77,765,053 (GRCm39) missense probably benign 0.01
R4423:Trpm2 UTSW 10 77,770,902 (GRCm39) missense probably benign 0.00
R4452:Trpm2 UTSW 10 77,759,427 (GRCm39) missense probably damaging 1.00
R4612:Trpm2 UTSW 10 77,781,750 (GRCm39) missense probably damaging 0.99
R4662:Trpm2 UTSW 10 77,773,972 (GRCm39) missense probably benign 0.05
R4825:Trpm2 UTSW 10 77,777,007 (GRCm39) missense probably damaging 0.98
R4906:Trpm2 UTSW 10 77,768,023 (GRCm39) nonsense probably null
R4943:Trpm2 UTSW 10 77,801,841 (GRCm39) missense probably damaging 1.00
R4948:Trpm2 UTSW 10 77,753,626 (GRCm39) missense probably benign 0.34
R5046:Trpm2 UTSW 10 77,801,852 (GRCm39) missense probably damaging 1.00
R5320:Trpm2 UTSW 10 77,759,355 (GRCm39) missense probably benign 0.06
R5523:Trpm2 UTSW 10 77,771,795 (GRCm39) missense probably benign 0.04
R5562:Trpm2 UTSW 10 77,795,773 (GRCm39) missense possibly damaging 0.71
R5623:Trpm2 UTSW 10 77,767,973 (GRCm39) missense probably damaging 0.96
R5628:Trpm2 UTSW 10 77,748,470 (GRCm39) missense probably benign 0.00
R5633:Trpm2 UTSW 10 77,774,187 (GRCm39) missense possibly damaging 0.71
R5817:Trpm2 UTSW 10 77,801,814 (GRCm39) missense probably damaging 1.00
R5989:Trpm2 UTSW 10 77,795,734 (GRCm39) missense probably damaging 1.00
R6018:Trpm2 UTSW 10 77,753,547 (GRCm39) missense probably benign 0.00
R6075:Trpm2 UTSW 10 77,770,877 (GRCm39) critical splice donor site probably null
R6092:Trpm2 UTSW 10 77,761,516 (GRCm39) missense probably benign 0.30
R6309:Trpm2 UTSW 10 77,774,202 (GRCm39) missense probably damaging 1.00
R6327:Trpm2 UTSW 10 77,768,061 (GRCm39) missense probably damaging 1.00
R6568:Trpm2 UTSW 10 77,773,660 (GRCm39) missense probably benign 0.01
R6579:Trpm2 UTSW 10 77,773,660 (GRCm39) missense probably benign 0.01
R6640:Trpm2 UTSW 10 77,773,660 (GRCm39) missense probably benign 0.01
R6642:Trpm2 UTSW 10 77,773,660 (GRCm39) missense probably benign 0.01
R6798:Trpm2 UTSW 10 77,750,574 (GRCm39) missense probably damaging 0.99
R6999:Trpm2 UTSW 10 77,771,725 (GRCm39) missense probably damaging 1.00
R7036:Trpm2 UTSW 10 77,748,426 (GRCm39) missense probably benign
R7113:Trpm2 UTSW 10 77,783,765 (GRCm39) missense probably damaging 0.96
R7171:Trpm2 UTSW 10 77,759,848 (GRCm39) missense probably damaging 1.00
R7240:Trpm2 UTSW 10 77,771,710 (GRCm39) critical splice donor site probably null
R7274:Trpm2 UTSW 10 77,759,389 (GRCm39) missense probably benign 0.00
R7379:Trpm2 UTSW 10 77,750,568 (GRCm39) missense probably benign
R7527:Trpm2 UTSW 10 77,801,894 (GRCm39) missense probably benign 0.01
R7571:Trpm2 UTSW 10 77,773,784 (GRCm39) missense probably benign 0.21
R7600:Trpm2 UTSW 10 77,773,885 (GRCm39) missense probably benign 0.02
R7727:Trpm2 UTSW 10 77,761,623 (GRCm39) missense probably benign 0.34
R7771:Trpm2 UTSW 10 77,768,013 (GRCm39) missense probably benign 0.01
R7844:Trpm2 UTSW 10 77,759,340 (GRCm39) missense probably benign 0.00
R8158:Trpm2 UTSW 10 77,783,731 (GRCm39) missense probably damaging 0.99
R8225:Trpm2 UTSW 10 77,783,807 (GRCm39) missense probably damaging 1.00
R8226:Trpm2 UTSW 10 77,783,807 (GRCm39) missense probably damaging 1.00
R8239:Trpm2 UTSW 10 77,771,836 (GRCm39) missense probably benign 0.06
R8275:Trpm2 UTSW 10 77,801,859 (GRCm39) nonsense probably null
R8340:Trpm2 UTSW 10 77,759,458 (GRCm39) nonsense probably null
R8354:Trpm2 UTSW 10 77,769,483 (GRCm39) missense probably damaging 1.00
R8427:Trpm2 UTSW 10 77,747,236 (GRCm39) missense possibly damaging 0.93
R8445:Trpm2 UTSW 10 77,746,086 (GRCm39) missense probably damaging 1.00
R8769:Trpm2 UTSW 10 77,768,128 (GRCm39) missense probably benign 0.00
R9144:Trpm2 UTSW 10 77,765,122 (GRCm39) missense probably benign 0.01
R9286:Trpm2 UTSW 10 77,777,014 (GRCm39) missense probably benign 0.06
R9319:Trpm2 UTSW 10 77,785,032 (GRCm39) missense probably damaging 1.00
R9319:Trpm2 UTSW 10 77,778,776 (GRCm39) nonsense probably null
R9381:Trpm2 UTSW 10 77,747,191 (GRCm39) missense possibly damaging 0.90
R9457:Trpm2 UTSW 10 77,747,226 (GRCm39) missense possibly damaging 0.82
R9477:Trpm2 UTSW 10 77,747,224 (GRCm39) missense probably benign 0.12
R9547:Trpm2 UTSW 10 77,748,467 (GRCm39) missense probably benign 0.33
R9660:Trpm2 UTSW 10 77,766,389 (GRCm39) missense probably benign 0.00
R9663:Trpm2 UTSW 10 77,756,320 (GRCm39) missense probably benign 0.01
Z1177:Trpm2 UTSW 10 77,773,702 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AAGAAGCAGATCCCTGTCTAAG -3'
(R):5'- CAGTGTCACTCAGCTAGCAAG -3'

Sequencing Primer
(F):5'- TGTCTAAGGATCCAGGATGGTATCAC -3'
(R):5'- AAGCTGACTCCGGACTGACAG -3'
Posted On 2019-05-13