Incidental Mutation 'R7034:Olfr794'
ID546549
Institutional Source Beutler Lab
Gene Symbol Olfr794
Ensembl Gene ENSMUSG00000044293
Gene Nameolfactory receptor 794
SynonymsGA_x6K02T2PULF-11248702-11249664, MOR114-11
MMRRC Submission
Accession Numbers

Genbank: NM_146378

Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R7034 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location129567655-129573110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 129571072 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 139 (C139Y)
Ref Sequence ENSEMBL: ENSMUSP00000145301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059957] [ENSMUST00000204820]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059957
AA Change: C139Y

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049790
Gene: ENSMUSG00000044293
AA Change: C139Y

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.8e-49 PFAM
Pfam:7tm_1 39 288 2e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204820
AA Change: C139Y

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145301
Gene: ENSMUSG00000044293
AA Change: C139Y

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.8e-49 PFAM
Pfam:7tm_1 39 288 2e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,609,256 probably null Het
9030624J02Rik T C 7: 118,773,092 S290P probably damaging Het
9130011E15Rik A G 19: 45,965,249 I195T probably damaging Het
Adamts1 T A 16: 85,802,746 probably benign Het
Aff4 A G 11: 53,408,409 K979E probably damaging Het
Aftph A T 11: 20,692,498 M845K probably damaging Het
Akt2 T C 7: 27,637,012 probably null Het
Aldh1a7 A T 19: 20,708,178 L336Q possibly damaging Het
Ank3 C T 10: 69,999,379 T680M probably damaging Het
Apeh T C 9: 108,094,271 E59G possibly damaging Het
Armc8 C T 9: 99,483,965 probably null Het
Atp2b1 C T 10: 98,987,310 T244I probably damaging Het
Btaf1 C A 19: 37,004,469 T1633K probably benign Het
Cacng8 A G 7: 3,415,303 S324G probably benign Het
Calcr T A 6: 3,692,543 Q400L probably damaging Het
Caprin2 G A 6: 148,848,205 P536S possibly damaging Het
Ccdc54 A T 16: 50,590,588 M105K probably benign Het
Ccna1 T C 3: 55,046,039 E381G possibly damaging Het
Cd2ap A T 17: 42,798,599 L623Q probably damaging Het
Cdkl3 A G 11: 52,027,215 E415G probably benign Het
Chd5 C A 4: 152,360,941 L430I possibly damaging Het
Clspn G A 4: 126,580,982 E975K possibly damaging Het
Cobl C A 11: 12,254,177 V835F probably damaging Het
D430041D05Rik C A 2: 104,192,538 R1037L probably damaging Het
Derl1 A G 15: 57,879,047 probably null Het
Dhrs9 T G 2: 69,393,176 N89K probably benign Het
Erich1 A G 8: 14,064,330 I60T probably benign Het
Fam126b T A 1: 58,535,537 M282L probably benign Het
Fam155a G A 8: 9,770,589 P144S possibly damaging Het
Fam184a A T 10: 53,694,814 S408T possibly damaging Het
Fcgr4 T A 1: 171,020,088 M85K probably benign Het
Foxj3 A G 4: 119,619,300 E259G probably damaging Het
Galnt11 T C 5: 25,258,813 I361T probably damaging Het
Gck A G 11: 5,901,747 S441P probably damaging Het
Gdap1l1 G T 2: 163,446,145 V98F probably damaging Het
Gm13089 A T 4: 143,697,328 I297N probably damaging Het
Gm884 T A 11: 103,615,812 probably benign Het
Gramd1a A G 7: 31,132,756 probably null Het
Herc3 A T 6: 58,876,855 M629L probably benign Het
Hist2h2ab C T 3: 96,219,988 Q25* probably null Het
Hoxc12 G A 15: 102,938,360 G229D probably damaging Het
Itga9 T C 9: 118,698,365 L528P probably benign Het
Krt39 A C 11: 99,521,236 V8G probably benign Het
Krt71 A G 15: 101,738,337 I312T probably benign Het
Mllt11 A G 3: 95,220,433 Y9H probably damaging Het
Mrgpra3 G T 7: 47,590,090 N29K possibly damaging Het
Mug1 A G 6: 121,873,644 T700A probably benign Het
Myl1 T C 1: 66,930,236 N79S probably damaging Het
Myo18b G A 5: 112,723,904 Q2104* probably null Het
Ndufs2 T C 1: 171,238,308 D256G probably benign Het
Nek5 T C 8: 22,107,723 N280S probably benign Het
Nwd2 A T 5: 63,804,915 N614I probably damaging Het
Parp1 G T 1: 180,598,252 K849N possibly damaging Het
Pcnx2 T C 8: 125,785,302 T1422A probably damaging Het
Plce1 A G 19: 38,739,357 N1520S probably damaging Het
Ppcdc T C 9: 57,415,170 T149A probably damaging Het
Ppl A G 16: 5,087,502 V1643A probably benign Het
Prrx1 T A 1: 163,248,338 M220L probably benign Het
Pspc1 A C 14: 56,758,628 probably null Het
Ptpn20 A G 14: 33,614,435 *44W probably null Het
Qars T A 9: 108,514,777 V83E probably damaging Het
Rbm33 T C 5: 28,394,498 M956T unknown Het
Sash1 C A 10: 8,730,083 E848* probably null Het
Scai T A 2: 39,121,135 Y163F probably damaging Het
Serpinf2 A T 11: 75,438,418 probably benign Het
Sgo2b T A 8: 63,926,834 H988L probably benign Het
Sh2b2 G A 5: 136,218,885 T604I probably benign Het
Skint4 A T 4: 112,158,084 I449F possibly damaging Het
Slc30a2 A G 4: 134,347,342 I88V possibly damaging Het
Smug1 A G 15: 103,155,942 L184P probably damaging Het
Spatc1 A G 15: 76,283,880 T180A probably benign Het
Ssr1 A T 13: 37,994,025 L20Q probably null Het
Supt4a A G 11: 87,743,258 E100G probably damaging Het
Teddm2 T C 1: 153,850,574 I132V probably benign Het
Tmem131 C T 1: 36,792,973 G1861E possibly damaging Het
Tpr A T 1: 150,423,607 H1186L probably benign Het
Trim34b A T 7: 104,329,536 probably benign Het
Trpm2 T C 10: 77,912,592 M1415V probably benign Het
Ttll12 A G 15: 83,586,885 F264S probably benign Het
Vmn2r59 T C 7: 42,046,220 E256G probably benign Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Wdfy3 G A 5: 101,907,518 T1562I probably damaging Het
Ybey T C 10: 76,468,363 S2G possibly damaging Het
Zfp346 A T 13: 55,132,387 Q308L probably benign Het
Other mutations in Olfr794
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01867:Olfr794 APN 10 129570827 missense possibly damaging 0.95
IGL02157:Olfr794 APN 10 129571150 missense probably damaging 1.00
IGL02804:Olfr794 APN 10 129571437 missense possibly damaging 0.60
IGL02833:Olfr794 APN 10 129570750 missense probably benign 0.26
IGL02930:Olfr794 APN 10 129571315 missense probably damaging 1.00
IGL03038:Olfr794 APN 10 129570921 missense probably benign 0.07
G4846:Olfr794 UTSW 10 129571170 missense probably damaging 1.00
R1539:Olfr794 UTSW 10 129570771 missense probably damaging 0.99
R1737:Olfr794 UTSW 10 129570828 missense probably damaging 1.00
R1845:Olfr794 UTSW 10 129571348 missense probably damaging 1.00
R2198:Olfr794 UTSW 10 129571046 nonsense probably null
R3086:Olfr794 UTSW 10 129571407 missense probably damaging 1.00
R4960:Olfr794 UTSW 10 129571026 missense probably damaging 1.00
R5938:Olfr794 UTSW 10 129571527 missense probably damaging 1.00
R6326:Olfr794 UTSW 10 129570702 missense possibly damaging 0.74
R6598:Olfr794 UTSW 10 129571369 missense probably damaging 1.00
R7066:Olfr794 UTSW 10 129571504 missense probably damaging 1.00
R7226:Olfr794 UTSW 10 129570715 missense probably benign 0.01
R7324:Olfr794 UTSW 10 129570849 missense probably damaging 1.00
R7408:Olfr794 UTSW 10 129570624 start gained probably benign
R7779:Olfr794 UTSW 10 129571311 missense probably damaging 1.00
Z1176:Olfr794 UTSW 10 129571236 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGTCTGTATTCCTAGATTCCTG -3'
(R):5'- GATGAAAGTCAGCACTGCAC -3'

Sequencing Primer
(F):5'- GTCTGTATTCCTAGATTCCTGTACAG -3'
(R):5'- TGCACAAACAATGACAGTCTG -3'
Posted On2019-05-13