Incidental Mutation 'R0610:Lrrk2'
ID 54655
Institutional Source Beutler Lab
Gene Symbol Lrrk2
Ensembl Gene ENSMUSG00000036273
Gene Name leucine-rich repeat kinase 2
Synonyms 4921513O20Rik, cI-46, D630001M17Rik, 9330188B09Rik, LOC381026
MMRRC Submission 038799-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.451) question?
Stock # R0610 (G1)
Quality Score 190
Status Validated
Chromosome 15
Chromosomal Location 91557378-91700323 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 91699619 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 2489 (I2489L)
Ref Sequence ENSEMBL: ENSMUSP00000052584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060642]
AlphaFold Q5S006
Predicted Effect probably benign
Transcript: ENSMUST00000060642
AA Change: I2489L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052584
Gene: ENSMUSG00000036273
AA Change: I2489L

DomainStartEndE-ValueType
low complexity region 138 156 N/A INTRINSIC
low complexity region 332 347 N/A INTRINSIC
ANK 708 737 3.95e1 SMART
ANK 770 800 4.58e2 SMART
low complexity region 890 901 N/A INTRINSIC
low complexity region 953 966 N/A INTRINSIC
low complexity region 971 979 N/A INTRINSIC
LRR 1010 1033 9.96e-1 SMART
LRR 1034 1057 8.01e0 SMART
LRR 1082 1105 2.45e0 SMART
LRR 1128 1151 9.3e-1 SMART
LRR 1195 1219 3.24e0 SMART
LRR 1244 1266 3.87e1 SMART
LRR 1267 1291 4.98e1 SMART
Pfam:Roc 1336 1456 4.9e-32 PFAM
Pfam:Ras 1336 1489 3.3e-17 PFAM
Pfam:COR 1524 1740 4e-28 PFAM
Pfam:Pkinase 1881 2132 4.7e-40 PFAM
Pfam:Pkinase_Tyr 1882 2132 6.8e-39 PFAM
WD40 2231 2276 3.09e-1 SMART
WD40 2401 2438 1.37e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172797
Meta Mutation Damage Score 0.0586 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the leucine-rich repeat kinase family and encodes a protein with an ankryin repeat region, a leucine-rich repeat (LRR) domain, a kinase domain, a DFG-like motif, a RAS domain, a GTPase domain, a MLK-like domain, and a WD40 domain. The protein is present largely in the cytoplasm but also associates with the mitochondrial outer membrane. Mutations in this gene have been associated with Parkinson disease-8. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired response to dopamine, amphetamine, and quinpirole. Mice homozygous for one knock-out allele exhibit increased neurite growth. Mice homozygous for different knock-out alleles exhibit alopecia due to excessive grooming or kdiney atrophy. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(6) Targeted, other(1)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,642,480 (GRCm39) T141S probably benign Het
4930578I06Rik G A 14: 64,223,714 (GRCm39) R21* probably null Het
Abca15 A G 7: 119,965,009 (GRCm39) E757G possibly damaging Het
Abca5 T C 11: 110,192,353 (GRCm39) T720A probably benign Het
Actr5 T A 2: 158,474,376 (GRCm39) probably null Het
Adgrl3 T C 5: 81,841,563 (GRCm39) probably benign Het
Adra1a A G 14: 66,875,241 (GRCm39) D72G probably damaging Het
Ahcyl T C 16: 45,974,264 (GRCm39) E371G probably damaging Het
Ahnak G T 19: 8,985,242 (GRCm39) L2175F probably benign Het
AK157302 A G 13: 21,679,833 (GRCm39) T120A possibly damaging Het
Apol7a G A 15: 77,273,454 (GRCm39) A336V probably benign Het
Asic1 C A 15: 99,596,780 (GRCm39) H525Q probably benign Het
Atxn7l2 T C 3: 108,112,090 (GRCm39) D335G possibly damaging Het
Bpgm G T 6: 34,481,284 (GRCm39) R227L possibly damaging Het
Calm4 T A 13: 3,888,320 (GRCm39) V142E possibly damaging Het
Catsperg1 A T 7: 28,890,044 (GRCm39) L721Q probably damaging Het
Cdh26 A G 2: 178,091,691 (GRCm39) I83M probably damaging Het
Cep295 A C 9: 15,234,050 (GRCm39) S2249A possibly damaging Het
Cfhr4 G A 1: 139,629,584 (GRCm39) T799I probably benign Het
Cln3 A G 7: 126,179,361 (GRCm39) F139L probably damaging Het
Cmpk2 T A 12: 26,528,055 (GRCm39) L424Q possibly damaging Het
Col12a1 A T 9: 79,615,130 (GRCm39) V53E probably benign Het
Csmd1 G A 8: 15,968,208 (GRCm39) R3140C possibly damaging Het
Dagla A G 19: 10,248,922 (GRCm39) W11R probably damaging Het
Dbx2 C T 15: 95,522,778 (GRCm39) V310M probably benign Het
Disp2 T A 2: 118,622,717 (GRCm39) C1150S probably benign Het
Dock3 T C 9: 106,900,987 (GRCm39) D326G probably damaging Het
Dph1 G T 11: 75,076,783 (GRCm39) probably benign Het
Dyrk1b C A 7: 27,886,059 (GRCm39) T594K probably damaging Het
Evx2 C A 2: 74,486,331 (GRCm39) A353S probably benign Het
Garin1b T A 6: 29,326,576 (GRCm39) V231E probably benign Het
Greb1 A C 12: 16,746,443 (GRCm39) S1276A probably benign Het
Hhipl1 T A 12: 108,285,661 (GRCm39) C490* probably null Het
Hmmr G T 11: 40,606,729 (GRCm39) T231K probably damaging Het
Hspa4l A C 3: 40,733,832 (GRCm39) E526D probably benign Het
Ibsp A G 5: 104,458,000 (GRCm39) E179G probably benign Het
Ift140 C T 17: 25,254,777 (GRCm39) A150V probably benign Het
Igf2bp2 A G 16: 21,889,059 (GRCm39) S416P probably benign Het
Ighe T C 12: 113,235,363 (GRCm39) K294E unknown Het
Ino80 G A 2: 119,213,441 (GRCm39) R1249C probably damaging Het
Iqca1 C A 1: 90,070,453 (GRCm39) G133V probably null Het
Kng2 T A 16: 22,819,344 (GRCm39) N231Y possibly damaging Het
Lca5 A T 9: 83,281,792 (GRCm39) C331S probably benign Het
Lrrc1 A G 9: 77,379,488 (GRCm39) I101T possibly damaging Het
Lyz3 A G 10: 117,073,635 (GRCm39) F66S probably benign Het
Mapk9 A C 11: 49,754,400 (GRCm39) N51T probably benign Het
Marf1 C T 16: 13,960,398 (GRCm39) A549T probably damaging Het
Nek2 T A 1: 191,554,627 (GRCm39) V113D probably damaging Het
Nr4a3 C A 4: 48,051,903 (GRCm39) A248E probably benign Het
Nrp1 T C 8: 129,229,099 (GRCm39) I859T probably damaging Het
Olfm5 A T 7: 103,803,652 (GRCm39) Y195* probably null Het
Or13j1 T A 4: 43,706,400 (GRCm39) H56L possibly damaging Het
Or1n2 T A 2: 36,797,671 (GRCm39) W238R probably damaging Het
Or8g35 A G 9: 39,381,119 (GRCm39) L301P probably damaging Het
Oxtr C T 6: 112,454,138 (GRCm39) R42Q probably benign Het
Pcnx2 A G 8: 126,566,426 (GRCm39) W1006R probably damaging Het
Pdpk1 T C 17: 24,317,145 (GRCm39) probably null Het
Ryr2 T A 13: 11,637,838 (GRCm39) H3731L probably damaging Het
Sdr16c5 T G 4: 4,016,116 (GRCm39) E103D possibly damaging Het
Setdb2 A C 14: 59,654,919 (GRCm39) S324A possibly damaging Het
Slc17a3 C T 13: 24,039,841 (GRCm39) S293F probably damaging Het
Slc17a8 A T 10: 89,412,488 (GRCm39) I499K probably damaging Het
Slc2a9 T A 5: 38,537,285 (GRCm39) I389F probably damaging Het
Slc30a1 T C 1: 191,641,536 (GRCm39) V394A probably damaging Het
Slc41a2 A G 10: 83,119,592 (GRCm39) I390T possibly damaging Het
Slco1a1 A G 6: 141,864,187 (GRCm39) probably null Het
Slit2 A G 5: 48,433,016 (GRCm39) K1053E possibly damaging Het
Smarca2 T A 19: 26,668,791 (GRCm39) L930Q probably damaging Het
Snx6 T C 12: 54,798,574 (GRCm39) H387R probably damaging Het
Sox5 A T 6: 143,779,165 (GRCm39) M622K possibly damaging Het
Ston1 C A 17: 88,942,709 (GRCm39) N38K possibly damaging Het
Strbp C T 2: 37,474,089 (GRCm39) V658I probably damaging Het
Strn3 T C 12: 51,657,231 (GRCm39) probably null Het
Suco T G 1: 161,687,072 (GRCm39) D96A probably benign Het
Suco A G 1: 161,691,601 (GRCm39) probably benign Het
Sytl2 A T 7: 90,030,061 (GRCm39) probably benign Het
Tmem41b T A 7: 109,580,290 (GRCm39) M25L probably benign Het
Tmem41b T A 7: 109,580,292 (GRCm39) D91V probably damaging Het
Tmem50b C T 16: 91,380,174 (GRCm39) A68T probably damaging Het
Tmprss11e G A 5: 86,855,206 (GRCm39) Q400* probably null Het
Tnfsf13b G A 8: 10,081,661 (GRCm39) probably null Het
Trappc8 A G 18: 20,970,245 (GRCm39) V916A probably damaging Het
Trdn G T 10: 33,350,449 (GRCm39) V673F probably damaging Het
Trim28 G T 7: 12,759,711 (GRCm39) probably benign Het
Txnrd2 T C 16: 18,291,632 (GRCm39) V427A probably damaging Het
Uggt1 T C 1: 36,204,587 (GRCm39) probably benign Het
Vmn1r36 A G 6: 66,693,404 (GRCm39) L51P probably damaging Het
Vmn1r63 T A 7: 5,806,063 (GRCm39) M190L possibly damaging Het
Vmn2r116 T A 17: 23,606,286 (GRCm39) N399K probably damaging Het
Vmn2r117 T C 17: 23,694,488 (GRCm39) N453S probably benign Het
Wbp1l T A 19: 46,643,109 (GRCm39) I370N probably damaging Het
Zfp445 T C 9: 122,682,046 (GRCm39) K632E probably benign Het
Zfp850 C T 7: 27,688,819 (GRCm39) R463H probably damaging Het
Zyg11a A G 4: 108,062,054 (GRCm39) L249P probably damaging Het
Other mutations in Lrrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Lrrk2 APN 15 91,632,002 (GRCm39) missense possibly damaging 0.90
IGL00542:Lrrk2 APN 15 91,584,146 (GRCm39) missense probably benign
IGL00770:Lrrk2 APN 15 91,686,036 (GRCm39) splice site probably benign
IGL00774:Lrrk2 APN 15 91,686,036 (GRCm39) splice site probably benign
IGL00791:Lrrk2 APN 15 91,664,044 (GRCm39) missense probably damaging 1.00
IGL00827:Lrrk2 APN 15 91,639,993 (GRCm39) missense probably damaging 1.00
IGL00843:Lrrk2 APN 15 91,641,261 (GRCm39) missense possibly damaging 0.58
IGL01109:Lrrk2 APN 15 91,623,035 (GRCm39) missense probably damaging 1.00
IGL01293:Lrrk2 APN 15 91,610,340 (GRCm39) missense probably benign 0.21
IGL01296:Lrrk2 APN 15 91,567,345 (GRCm39) missense probably benign
IGL01301:Lrrk2 APN 15 91,651,542 (GRCm39) missense probably damaging 1.00
IGL01360:Lrrk2 APN 15 91,584,772 (GRCm39) splice site probably null
IGL01465:Lrrk2 APN 15 91,613,128 (GRCm39) missense probably benign 0.21
IGL01529:Lrrk2 APN 15 91,696,516 (GRCm39) missense possibly damaging 0.92
IGL01557:Lrrk2 APN 15 91,584,192 (GRCm39) missense probably damaging 1.00
IGL01560:Lrrk2 APN 15 91,659,191 (GRCm39) missense probably benign 0.33
IGL01991:Lrrk2 APN 15 91,664,149 (GRCm39) missense probably damaging 0.99
IGL02003:Lrrk2 APN 15 91,615,694 (GRCm39) missense probably damaging 0.99
IGL02325:Lrrk2 APN 15 91,610,511 (GRCm39) critical splice donor site probably null
IGL02711:Lrrk2 APN 15 91,570,025 (GRCm39) missense possibly damaging 0.71
IGL02869:Lrrk2 APN 15 91,634,480 (GRCm39) missense probably damaging 1.00
IGL03104:Lrrk2 APN 15 91,631,958 (GRCm39) missense possibly damaging 0.68
IGL03179:Lrrk2 APN 15 91,584,781 (GRCm39) missense probably damaging 1.00
IGL03395:Lrrk2 APN 15 91,681,617 (GRCm39) splice site probably null
horned UTSW 15 91,657,061 (GRCm39) missense probably damaging 1.00
R1312_Lrrk2_980 UTSW 15 91,584,098 (GRCm39) missense probably damaging 1.00
R4710_lrrk2_232 UTSW 15 91,584,130 (GRCm39) missense possibly damaging 0.88
R5245_Lrrk2_127 UTSW 15 91,680,292 (GRCm39) missense probably damaging 1.00
spree UTSW 15 91,586,450 (GRCm39) missense probably benign 0.00
Spur UTSW 15 91,659,198 (GRCm39) nonsense probably null
3-1:Lrrk2 UTSW 15 91,686,137 (GRCm39) missense probably benign 0.01
ANU18:Lrrk2 UTSW 15 91,651,542 (GRCm39) missense probably damaging 1.00
H8562:Lrrk2 UTSW 15 91,557,561 (GRCm39) missense probably benign
H8786:Lrrk2 UTSW 15 91,557,561 (GRCm39) missense probably benign
IGL02835:Lrrk2 UTSW 15 91,698,863 (GRCm39) critical splice acceptor site probably null
R0014:Lrrk2 UTSW 15 91,686,248 (GRCm39) splice site probably benign
R0014:Lrrk2 UTSW 15 91,686,248 (GRCm39) splice site probably benign
R0078:Lrrk2 UTSW 15 91,618,212 (GRCm39) missense probably benign 0.01
R0100:Lrrk2 UTSW 15 91,629,999 (GRCm39) missense probably damaging 1.00
R0282:Lrrk2 UTSW 15 91,662,617 (GRCm39) splice site probably benign
R0448:Lrrk2 UTSW 15 91,593,508 (GRCm39) missense probably damaging 0.99
R0449:Lrrk2 UTSW 15 91,634,478 (GRCm39) missense probably damaging 1.00
R0617:Lrrk2 UTSW 15 91,636,481 (GRCm39) missense probably benign 0.00
R0632:Lrrk2 UTSW 15 91,680,231 (GRCm39) missense probably damaging 0.98
R0639:Lrrk2 UTSW 15 91,657,199 (GRCm39) missense probably benign 0.03
R0661:Lrrk2 UTSW 15 91,671,219 (GRCm39) missense probably damaging 1.00
R0666:Lrrk2 UTSW 15 91,641,273 (GRCm39) critical splice donor site probably null
R0764:Lrrk2 UTSW 15 91,659,249 (GRCm39) splice site probably null
R0766:Lrrk2 UTSW 15 91,584,098 (GRCm39) missense probably damaging 1.00
R0845:Lrrk2 UTSW 15 91,640,165 (GRCm39) missense probably benign 0.22
R0940:Lrrk2 UTSW 15 91,613,284 (GRCm39) missense possibly damaging 0.83
R0970:Lrrk2 UTSW 15 91,613,372 (GRCm39) missense probably benign 0.22
R1080:Lrrk2 UTSW 15 91,557,892 (GRCm39) missense probably benign 0.01
R1114:Lrrk2 UTSW 15 91,584,671 (GRCm39) nonsense probably null
R1223:Lrrk2 UTSW 15 91,557,838 (GRCm39) missense probably benign 0.00
R1289:Lrrk2 UTSW 15 91,696,563 (GRCm39) missense probably benign 0.00
R1296:Lrrk2 UTSW 15 91,613,123 (GRCm39) missense probably damaging 1.00
R1312:Lrrk2 UTSW 15 91,584,098 (GRCm39) missense probably damaging 1.00
R1637:Lrrk2 UTSW 15 91,618,261 (GRCm39) missense probably benign
R1773:Lrrk2 UTSW 15 91,664,184 (GRCm39) missense possibly damaging 0.96
R1809:Lrrk2 UTSW 15 91,584,095 (GRCm39) missense possibly damaging 0.86
R1839:Lrrk2 UTSW 15 91,567,337 (GRCm39) missense probably benign 0.00
R1946:Lrrk2 UTSW 15 91,620,864 (GRCm39) splice site probably null
R2160:Lrrk2 UTSW 15 91,680,263 (GRCm39) missense probably damaging 1.00
R2232:Lrrk2 UTSW 15 91,648,919 (GRCm39) missense probably benign 0.05
R2419:Lrrk2 UTSW 15 91,681,729 (GRCm39) splice site probably benign
R2516:Lrrk2 UTSW 15 91,640,130 (GRCm39) missense probably benign
R3110:Lrrk2 UTSW 15 91,698,898 (GRCm39) missense probably benign 0.02
R3112:Lrrk2 UTSW 15 91,698,898 (GRCm39) missense probably benign 0.02
R3801:Lrrk2 UTSW 15 91,621,314 (GRCm39) missense probably benign
R3842:Lrrk2 UTSW 15 91,640,119 (GRCm39) missense probably benign 0.01
R3903:Lrrk2 UTSW 15 91,631,904 (GRCm39) missense probably damaging 1.00
R3903:Lrrk2 UTSW 15 91,631,903 (GRCm39) missense probably damaging 1.00
R3930:Lrrk2 UTSW 15 91,651,664 (GRCm39) critical splice donor site probably null
R3937:Lrrk2 UTSW 15 91,662,707 (GRCm39) missense probably damaging 0.98
R3938:Lrrk2 UTSW 15 91,662,707 (GRCm39) missense probably damaging 0.98
R3938:Lrrk2 UTSW 15 91,596,983 (GRCm39) missense possibly damaging 0.69
R3982:Lrrk2 UTSW 15 91,593,487 (GRCm39) missense probably benign 0.22
R4125:Lrrk2 UTSW 15 91,699,686 (GRCm39) missense probably benign 0.01
R4130:Lrrk2 UTSW 15 91,639,997 (GRCm39) missense probably benign 0.19
R4296:Lrrk2 UTSW 15 91,584,098 (GRCm39) missense probably damaging 1.00
R4465:Lrrk2 UTSW 15 91,632,023 (GRCm39) missense probably damaging 0.96
R4478:Lrrk2 UTSW 15 91,607,391 (GRCm39) missense probably damaging 1.00
R4517:Lrrk2 UTSW 15 91,589,323 (GRCm39) missense probably benign
R4539:Lrrk2 UTSW 15 91,613,345 (GRCm39) missense possibly damaging 0.86
R4654:Lrrk2 UTSW 15 91,649,884 (GRCm39) missense probably damaging 0.96
R4710:Lrrk2 UTSW 15 91,584,130 (GRCm39) missense possibly damaging 0.88
R4722:Lrrk2 UTSW 15 91,573,104 (GRCm39) missense probably damaging 1.00
R4723:Lrrk2 UTSW 15 91,648,962 (GRCm39) missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91,649,950 (GRCm39) missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91,573,052 (GRCm39) missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91,649,950 (GRCm39) missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91,573,052 (GRCm39) missense probably damaging 1.00
R4787:Lrrk2 UTSW 15 91,597,031 (GRCm39) missense probably benign
R4945:Lrrk2 UTSW 15 91,689,123 (GRCm39) missense probably benign 0.02
R4948:Lrrk2 UTSW 15 91,687,592 (GRCm39) missense probably benign 0.20
R5000:Lrrk2 UTSW 15 91,634,081 (GRCm39) missense probably damaging 1.00
R5031:Lrrk2 UTSW 15 91,584,822 (GRCm39) missense possibly damaging 0.50
R5067:Lrrk2 UTSW 15 91,649,993 (GRCm39) missense probably benign 0.01
R5245:Lrrk2 UTSW 15 91,680,292 (GRCm39) missense probably damaging 1.00
R5341:Lrrk2 UTSW 15 91,657,061 (GRCm39) missense probably damaging 1.00
R5460:Lrrk2 UTSW 15 91,698,847 (GRCm39) splice site probably null
R5551:Lrrk2 UTSW 15 91,696,553 (GRCm39) missense probably benign
R5574:Lrrk2 UTSW 15 91,671,219 (GRCm39) missense probably damaging 1.00
R5577:Lrrk2 UTSW 15 91,649,948 (GRCm39) missense probably damaging 1.00
R5685:Lrrk2 UTSW 15 91,687,504 (GRCm39) nonsense probably null
R5712:Lrrk2 UTSW 15 91,586,425 (GRCm39) nonsense probably null
R5728:Lrrk2 UTSW 15 91,659,177 (GRCm39) missense probably benign 0.36
R5782:Lrrk2 UTSW 15 91,586,386 (GRCm39) missense probably damaging 1.00
R5788:Lrrk2 UTSW 15 91,648,851 (GRCm39) missense possibly damaging 0.55
R5821:Lrrk2 UTSW 15 91,593,593 (GRCm39) critical splice donor site probably null
R5852:Lrrk2 UTSW 15 91,640,152 (GRCm39) missense probably damaging 1.00
R5934:Lrrk2 UTSW 15 91,618,249 (GRCm39) missense probably benign 0.00
R5935:Lrrk2 UTSW 15 91,630,034 (GRCm39) missense probably benign 0.14
R5979:Lrrk2 UTSW 15 91,657,148 (GRCm39) missense possibly damaging 0.47
R6101:Lrrk2 UTSW 15 91,607,338 (GRCm39) missense probably benign 0.10
R6114:Lrrk2 UTSW 15 91,632,029 (GRCm39) missense probably benign 0.33
R6259:Lrrk2 UTSW 15 91,586,450 (GRCm39) missense probably benign 0.00
R6376:Lrrk2 UTSW 15 91,626,469 (GRCm39) missense possibly damaging 0.89
R6417:Lrrk2 UTSW 15 91,696,549 (GRCm39) missense probably benign 0.03
R6420:Lrrk2 UTSW 15 91,696,549 (GRCm39) missense probably benign 0.03
R6737:Lrrk2 UTSW 15 91,607,421 (GRCm39) missense possibly damaging 0.50
R7056:Lrrk2 UTSW 15 91,659,198 (GRCm39) nonsense probably null
R7072:Lrrk2 UTSW 15 91,686,123 (GRCm39) missense probably benign 0.03
R7109:Lrrk2 UTSW 15 91,648,985 (GRCm39) missense probably damaging 1.00
R7128:Lrrk2 UTSW 15 91,686,088 (GRCm39) missense probably benign
R7144:Lrrk2 UTSW 15 91,618,258 (GRCm39) missense possibly damaging 0.54
R7187:Lrrk2 UTSW 15 91,641,204 (GRCm39) missense possibly damaging 0.92
R7270:Lrrk2 UTSW 15 91,584,644 (GRCm39) missense probably benign 0.01
R7356:Lrrk2 UTSW 15 91,622,947 (GRCm39) missense probably benign 0.07
R7360:Lrrk2 UTSW 15 91,615,858 (GRCm39) critical splice donor site probably null
R7373:Lrrk2 UTSW 15 91,584,207 (GRCm39) critical splice donor site probably null
R7465:Lrrk2 UTSW 15 91,651,543 (GRCm39) missense probably damaging 1.00
R7477:Lrrk2 UTSW 15 91,696,528 (GRCm39) missense probably damaging 0.98
R7614:Lrrk2 UTSW 15 91,657,061 (GRCm39) missense probably damaging 1.00
R7622:Lrrk2 UTSW 15 91,696,526 (GRCm39) missense probably damaging 1.00
R7658:Lrrk2 UTSW 15 91,584,561 (GRCm39) missense possibly damaging 0.91
R7679:Lrrk2 UTSW 15 91,610,389 (GRCm39) missense possibly damaging 0.58
R7737:Lrrk2 UTSW 15 91,699,649 (GRCm39) missense probably damaging 0.98
R7739:Lrrk2 UTSW 15 91,584,816 (GRCm39) missense probably damaging 1.00
R7740:Lrrk2 UTSW 15 91,651,527 (GRCm39) missense probably damaging 1.00
R7908:Lrrk2 UTSW 15 91,610,355 (GRCm39) missense probably damaging 1.00
R8299:Lrrk2 UTSW 15 91,557,443 (GRCm39) start gained probably benign
R8389:Lrrk2 UTSW 15 91,584,194 (GRCm39) missense probably damaging 1.00
R8462:Lrrk2 UTSW 15 91,615,680 (GRCm39) missense probably benign
R8698:Lrrk2 UTSW 15 91,636,400 (GRCm39) missense probably benign 0.38
R8947:Lrrk2 UTSW 15 91,586,473 (GRCm39) nonsense probably null
R9084:Lrrk2 UTSW 15 91,634,469 (GRCm39) missense
R9086:Lrrk2 UTSW 15 91,640,051 (GRCm39) missense probably benign 0.01
R9096:Lrrk2 UTSW 15 91,557,459 (GRCm39) start gained probably benign
R9097:Lrrk2 UTSW 15 91,557,459 (GRCm39) start gained probably benign
R9267:Lrrk2 UTSW 15 91,584,629 (GRCm39) missense probably damaging 0.99
R9285:Lrrk2 UTSW 15 91,662,686 (GRCm39) missense probably damaging 1.00
R9341:Lrrk2 UTSW 15 91,584,618 (GRCm39) missense probably benign 0.18
R9343:Lrrk2 UTSW 15 91,584,618 (GRCm39) missense probably benign 0.18
R9371:Lrrk2 UTSW 15 91,607,407 (GRCm39) missense probably damaging 1.00
R9424:Lrrk2 UTSW 15 91,636,388 (GRCm39) nonsense probably null
R9489:Lrrk2 UTSW 15 91,621,420 (GRCm39) missense probably benign 0.37
R9502:Lrrk2 UTSW 15 91,607,365 (GRCm39) missense probably damaging 0.98
R9563:Lrrk2 UTSW 15 91,634,043 (GRCm39) missense possibly damaging 0.90
R9576:Lrrk2 UTSW 15 91,636,388 (GRCm39) nonsense probably null
R9605:Lrrk2 UTSW 15 91,621,420 (GRCm39) missense probably benign 0.37
R9635:Lrrk2 UTSW 15 91,696,527 (GRCm39) missense probably benign 0.21
R9641:Lrrk2 UTSW 15 91,671,251 (GRCm39) missense possibly damaging 0.94
R9660:Lrrk2 UTSW 15 91,618,228 (GRCm39) missense probably benign 0.00
R9673:Lrrk2 UTSW 15 91,649,884 (GRCm39) missense probably damaging 1.00
R9708:Lrrk2 UTSW 15 91,634,482 (GRCm39) nonsense probably null
R9728:Lrrk2 UTSW 15 91,618,228 (GRCm39) missense probably benign 0.00
R9757:Lrrk2 UTSW 15 91,695,229 (GRCm39) missense probably benign 0.03
RF001:Lrrk2 UTSW 15 91,620,836 (GRCm39) missense probably benign 0.11
X0028:Lrrk2 UTSW 15 91,623,054 (GRCm39) missense probably benign 0.00
Z1088:Lrrk2 UTSW 15 91,610,443 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TCCCATCAGCAATTCCAATTCACGA -3'
(R):5'- CCGCTGAGTCCATAGATAATCAAGCAA -3'

Sequencing Primer
(F):5'- ATGCTGGGTTCTAAAATGCTCTTC -3'
(R):5'- CTAACATATTGGCGAGGATGTCTG -3'
Posted On 2013-07-11