Incidental Mutation 'R7034:Btaf1'
ID 546575
Institutional Source Beutler Lab
Gene Symbol Btaf1
Ensembl Gene ENSMUSG00000040565
Gene Name B-TFIID TATA-box binding protein associated factor 1
Synonyms E430027O22Rik
MMRRC Submission 045135-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.967) question?
Stock # R7034 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 36903479-36990152 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 36981869 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 1633 (T1633K)
Ref Sequence ENSEMBL: ENSMUSP00000097093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099494]
AlphaFold E9QAE3
Predicted Effect probably benign
Transcript: ENSMUST00000099494
AA Change: T1633K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097093
Gene: ENSMUSG00000040565
AA Change: T1633K

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
low complexity region 143 152 N/A INTRINSIC
PDB:3OC3|B 276 414 3e-6 PDB
low complexity region 438 454 N/A INTRINSIC
Pfam:DUF3535 585 1051 1.1e-133 PFAM
low complexity region 1099 1110 N/A INTRINSIC
low complexity region 1177 1192 N/A INTRINSIC
DEXDc 1261 1469 3.02e-30 SMART
low complexity region 1630 1641 N/A INTRINSIC
HELICc 1657 1743 2.22e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TAF (TATA box-binding protein-associated factor), which associates with TBP (TATA box-binding protein) to form the B-TFIID complex that is required for transcription initiation of genes by RNA polymerase II. This TAF has DNA-dependent ATPase activity, which drives the dissociation of TBP from DNA, freeing the TBP to associate with other TATA boxes or TATA-less promoters. [provided by RefSeq, Sep 2011]
PHENOTYPE: Embryos homozygous for a gene-trapped allele display growth retardation. Embryos homozygous for an ENU-induced allele show growth retardation, edema, abnormal blood circulation, myocardial trabeculae hypoplasia, and delayed head and brain development. [provided by MGI curators]
Allele List at MGI

All alleles(40) : Gene trapped(40)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,445,118 (GRCm39) probably null Het
Adamts1 T A 16: 85,599,634 (GRCm39) probably benign Het
Aff4 A G 11: 53,299,236 (GRCm39) K979E probably damaging Het
Aftph A T 11: 20,642,498 (GRCm39) M845K probably damaging Het
Akt2 T C 7: 27,336,437 (GRCm39) probably null Het
Aldh1a7 A T 19: 20,685,542 (GRCm39) L336Q possibly damaging Het
Ank3 C T 10: 69,835,209 (GRCm39) T680M probably damaging Het
Apeh T C 9: 107,971,470 (GRCm39) E59G possibly damaging Het
Armc8 C T 9: 99,366,018 (GRCm39) probably null Het
Armh3 A G 19: 45,953,688 (GRCm39) I195T probably damaging Het
Atp2b1 C T 10: 98,823,172 (GRCm39) T244I probably damaging Het
Cacng8 A G 7: 3,463,819 (GRCm39) S324G probably benign Het
Calcr T A 6: 3,692,543 (GRCm39) Q400L probably damaging Het
Caprin2 G A 6: 148,749,703 (GRCm39) P536S possibly damaging Het
Ccdc54 A T 16: 50,410,951 (GRCm39) M105K probably benign Het
Ccna1 T C 3: 54,953,460 (GRCm39) E381G possibly damaging Het
Cd2ap A T 17: 43,109,490 (GRCm39) L623Q probably damaging Het
Cdkl3 A G 11: 51,918,042 (GRCm39) E415G probably benign Het
Chd5 C A 4: 152,445,398 (GRCm39) L430I possibly damaging Het
Clspn G A 4: 126,474,775 (GRCm39) E975K possibly damaging Het
Cobl C A 11: 12,204,177 (GRCm39) V835F probably damaging Het
D430041D05Rik C A 2: 104,022,883 (GRCm39) R1037L probably damaging Het
Derl1 A G 15: 57,742,443 (GRCm39) probably null Het
Dhrs9 T G 2: 69,223,520 (GRCm39) N89K probably benign Het
Erich1 A G 8: 14,114,330 (GRCm39) I60T probably benign Het
Fam184a A T 10: 53,570,910 (GRCm39) S408T possibly damaging Het
Fcgr4 T A 1: 170,847,657 (GRCm39) M85K probably benign Het
Foxj3 A G 4: 119,476,497 (GRCm39) E259G probably damaging Het
Galnt11 T C 5: 25,463,811 (GRCm39) I361T probably damaging Het
Gck A G 11: 5,851,747 (GRCm39) S441P probably damaging Het
Gdap1l1 G T 2: 163,288,065 (GRCm39) V98F probably damaging Het
Gramd1a A G 7: 30,832,181 (GRCm39) probably null Het
H2ac21 C T 3: 96,127,304 (GRCm39) Q25* probably null Het
Herc3 A T 6: 58,853,840 (GRCm39) M629L probably benign Het
Hoxc12 G A 15: 102,846,795 (GRCm39) G229D probably damaging Het
Hycc2 T A 1: 58,574,696 (GRCm39) M282L probably benign Het
Itga9 T C 9: 118,527,433 (GRCm39) L528P probably benign Het
Krt39 A C 11: 99,412,062 (GRCm39) V8G probably benign Het
Krt71 A G 15: 101,646,772 (GRCm39) I312T probably benign Het
Lrrc37 T A 11: 103,506,638 (GRCm39) probably benign Het
Mllt11 A G 3: 95,127,744 (GRCm39) Y9H probably damaging Het
Mrgpra3 G T 7: 47,239,838 (GRCm39) N29K possibly damaging Het
Mug1 A G 6: 121,850,603 (GRCm39) T700A probably benign Het
Myl1 T C 1: 66,969,395 (GRCm39) N79S probably damaging Het
Myo18b G A 5: 112,871,770 (GRCm39) Q2104* probably null Het
Nalf1 G A 8: 9,820,589 (GRCm39) P144S possibly damaging Het
Ndufs2 T C 1: 171,065,877 (GRCm39) D256G probably benign Het
Nek5 T C 8: 22,597,739 (GRCm39) N280S probably benign Het
Nwd2 A T 5: 63,962,258 (GRCm39) N614I probably damaging Het
Or6c88 G A 10: 129,406,941 (GRCm39) C139Y possibly damaging Het
Parp1 G T 1: 180,425,817 (GRCm39) K849N possibly damaging Het
Pcnx2 T C 8: 126,512,041 (GRCm39) T1422A probably damaging Het
Plce1 A G 19: 38,727,801 (GRCm39) N1520S probably damaging Het
Ppcdc T C 9: 57,322,453 (GRCm39) T149A probably damaging Het
Ppl A G 16: 4,905,366 (GRCm39) V1643A probably benign Het
Pramel23 A T 4: 143,423,898 (GRCm39) I297N probably damaging Het
Prrx1 T A 1: 163,075,907 (GRCm39) M220L probably benign Het
Pspc1 A C 14: 56,996,085 (GRCm39) probably null Het
Ptpn20 A G 14: 33,336,392 (GRCm39) *44W probably null Het
Qars1 T A 9: 108,391,976 (GRCm39) V83E probably damaging Het
Rbm33 T C 5: 28,599,496 (GRCm39) M956T unknown Het
Sash1 C A 10: 8,605,847 (GRCm39) E848* probably null Het
Scai T A 2: 39,011,147 (GRCm39) Y163F probably damaging Het
Serpinf2 A T 11: 75,329,244 (GRCm39) probably benign Het
Sgo2b T A 8: 64,379,868 (GRCm39) H988L probably benign Het
Sh2b2 G A 5: 136,247,739 (GRCm39) T604I probably benign Het
Skint4 A T 4: 112,015,281 (GRCm39) I449F possibly damaging Het
Slc30a2 A G 4: 134,074,653 (GRCm39) I88V possibly damaging Het
Smug1 A G 15: 103,064,369 (GRCm39) L184P probably damaging Het
Spatc1 A G 15: 76,168,080 (GRCm39) T180A probably benign Het
Ssr1 A T 13: 38,178,001 (GRCm39) L20Q probably null Het
Supt4a A G 11: 87,634,084 (GRCm39) E100G probably damaging Het
Teddm2 T C 1: 153,726,320 (GRCm39) I132V probably benign Het
Tmem131 C T 1: 36,832,054 (GRCm39) G1861E possibly damaging Het
Tpr A T 1: 150,299,358 (GRCm39) H1186L probably benign Het
Trim34b A T 7: 103,978,743 (GRCm39) probably benign Het
Trpm2 T C 10: 77,748,426 (GRCm39) M1415V probably benign Het
Ttll12 A G 15: 83,471,086 (GRCm39) F264S probably benign Het
Vmn2r59 T C 7: 41,695,644 (GRCm39) E256G probably benign Het
Vmn2r93 A T 17: 18,546,672 (GRCm39) H848L probably benign Het
Vps35l T C 7: 118,372,315 (GRCm39) S290P probably damaging Het
Wdfy3 G A 5: 102,055,384 (GRCm39) T1562I probably damaging Het
Ybey T C 10: 76,304,197 (GRCm39) S2G possibly damaging Het
Zfp346 A T 13: 55,280,200 (GRCm39) Q308L probably benign Het
Other mutations in Btaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Btaf1 APN 19 36,987,102 (GRCm39) missense probably damaging 1.00
IGL00535:Btaf1 APN 19 36,974,935 (GRCm39) missense probably damaging 1.00
IGL00574:Btaf1 APN 19 36,947,330 (GRCm39) missense probably benign 0.00
IGL00969:Btaf1 APN 19 36,988,652 (GRCm39) splice site probably benign
IGL01325:Btaf1 APN 19 36,982,049 (GRCm39) splice site probably benign
IGL01399:Btaf1 APN 19 36,977,570 (GRCm39) nonsense probably null
IGL02024:Btaf1 APN 19 36,969,826 (GRCm39) splice site probably benign
IGL02471:Btaf1 APN 19 36,977,592 (GRCm39) missense probably damaging 0.96
IGL02664:Btaf1 APN 19 36,955,828 (GRCm39) splice site probably benign
IGL02898:Btaf1 APN 19 36,946,468 (GRCm39) missense probably benign
IGL02995:Btaf1 APN 19 36,958,535 (GRCm39) splice site probably benign
IGL03023:Btaf1 APN 19 36,987,415 (GRCm39) missense possibly damaging 0.85
IGL03188:Btaf1 APN 19 36,926,508 (GRCm39) missense possibly damaging 0.91
IGL03353:Btaf1 APN 19 36,969,900 (GRCm39) missense probably damaging 1.00
freudenberg UTSW 19 36,965,573 (GRCm39) critical splice donor site probably null
Galanos UTSW 19 36,926,502 (GRCm39) missense probably damaging 1.00
3-1:Btaf1 UTSW 19 36,987,478 (GRCm39) missense probably damaging 1.00
R0013:Btaf1 UTSW 19 36,935,773 (GRCm39) missense probably benign
R0048:Btaf1 UTSW 19 36,980,924 (GRCm39) missense probably benign 0.01
R0117:Btaf1 UTSW 19 36,947,368 (GRCm39) missense probably benign 0.06
R0207:Btaf1 UTSW 19 36,987,048 (GRCm39) nonsense probably null
R0310:Btaf1 UTSW 19 36,981,934 (GRCm39) missense probably damaging 0.96
R0377:Btaf1 UTSW 19 36,966,402 (GRCm39) missense probably benign
R0419:Btaf1 UTSW 19 36,922,629 (GRCm39) missense probably damaging 0.99
R0440:Btaf1 UTSW 19 36,964,053 (GRCm39) missense probably damaging 0.99
R0532:Btaf1 UTSW 19 36,928,586 (GRCm39) splice site probably benign
R0612:Btaf1 UTSW 19 36,946,537 (GRCm39) missense probably damaging 0.99
R0731:Btaf1 UTSW 19 36,974,895 (GRCm39) splice site probably null
R0780:Btaf1 UTSW 19 36,966,322 (GRCm39) missense probably damaging 0.99
R0919:Btaf1 UTSW 19 36,968,143 (GRCm39) missense probably benign 0.03
R1104:Btaf1 UTSW 19 36,982,002 (GRCm39) missense probably damaging 1.00
R1263:Btaf1 UTSW 19 36,933,924 (GRCm39) missense probably benign 0.10
R1325:Btaf1 UTSW 19 36,946,562 (GRCm39) missense possibly damaging 0.68
R1447:Btaf1 UTSW 19 36,969,854 (GRCm39) missense probably benign 0.00
R1554:Btaf1 UTSW 19 36,973,998 (GRCm39) missense probably benign 0.02
R1649:Btaf1 UTSW 19 36,959,122 (GRCm39) missense probably benign
R1715:Btaf1 UTSW 19 36,946,521 (GRCm39) missense probably damaging 0.99
R1733:Btaf1 UTSW 19 36,972,362 (GRCm39) missense probably benign
R1764:Btaf1 UTSW 19 36,928,518 (GRCm39) missense probably benign 0.12
R1874:Btaf1 UTSW 19 36,957,983 (GRCm39) missense probably benign
R1911:Btaf1 UTSW 19 36,964,030 (GRCm39) missense probably benign
R1933:Btaf1 UTSW 19 36,950,357 (GRCm39) missense probably damaging 1.00
R2080:Btaf1 UTSW 19 36,928,548 (GRCm39) missense probably benign 0.09
R2483:Btaf1 UTSW 19 36,958,486 (GRCm39) missense probably benign 0.02
R2510:Btaf1 UTSW 19 36,979,845 (GRCm39) missense probably benign 0.08
R3623:Btaf1 UTSW 19 36,958,486 (GRCm39) missense probably benign 0.02
R3624:Btaf1 UTSW 19 36,958,486 (GRCm39) missense probably benign 0.02
R3801:Btaf1 UTSW 19 36,966,373 (GRCm39) missense probably benign 0.00
R3801:Btaf1 UTSW 19 36,963,948 (GRCm39) missense probably benign
R3802:Btaf1 UTSW 19 36,966,373 (GRCm39) missense probably benign 0.00
R3802:Btaf1 UTSW 19 36,963,948 (GRCm39) missense probably benign
R3803:Btaf1 UTSW 19 36,966,373 (GRCm39) missense probably benign 0.00
R3803:Btaf1 UTSW 19 36,963,948 (GRCm39) missense probably benign
R4077:Btaf1 UTSW 19 36,963,879 (GRCm39) missense probably benign 0.00
R4079:Btaf1 UTSW 19 36,963,879 (GRCm39) missense probably benign 0.00
R4133:Btaf1 UTSW 19 36,939,138 (GRCm39) missense probably benign 0.00
R4673:Btaf1 UTSW 19 36,955,772 (GRCm39) missense probably benign 0.00
R4731:Btaf1 UTSW 19 36,958,478 (GRCm39) missense probably benign 0.03
R4796:Btaf1 UTSW 19 36,933,828 (GRCm39) missense possibly damaging 0.95
R4824:Btaf1 UTSW 19 36,958,448 (GRCm39) missense possibly damaging 0.84
R4835:Btaf1 UTSW 19 36,979,858 (GRCm39) missense probably benign 0.00
R4837:Btaf1 UTSW 19 36,944,185 (GRCm39) missense probably benign
R4925:Btaf1 UTSW 19 36,988,733 (GRCm39) missense probably benign
R4968:Btaf1 UTSW 19 36,947,351 (GRCm39) missense probably null 0.71
R4976:Btaf1 UTSW 19 36,963,979 (GRCm39) missense probably benign
R5001:Btaf1 UTSW 19 36,964,052 (GRCm39) missense possibly damaging 0.90
R5037:Btaf1 UTSW 19 36,980,931 (GRCm39) missense probably damaging 1.00
R5039:Btaf1 UTSW 19 36,968,162 (GRCm39) missense probably benign
R5211:Btaf1 UTSW 19 36,973,962 (GRCm39) missense probably benign 0.32
R5422:Btaf1 UTSW 19 36,928,507 (GRCm39) missense probably benign 0.09
R5429:Btaf1 UTSW 19 36,972,257 (GRCm39) missense possibly damaging 0.58
R5530:Btaf1 UTSW 19 36,968,175 (GRCm39) missense possibly damaging 0.85
R5582:Btaf1 UTSW 19 36,965,573 (GRCm39) critical splice donor site probably null
R5654:Btaf1 UTSW 19 36,961,015 (GRCm39) missense probably benign 0.35
R5744:Btaf1 UTSW 19 36,981,890 (GRCm39) missense probably benign 0.02
R6082:Btaf1 UTSW 19 36,960,942 (GRCm39) missense probably damaging 1.00
R6243:Btaf1 UTSW 19 36,958,520 (GRCm39) missense probably benign 0.02
R6291:Btaf1 UTSW 19 36,950,408 (GRCm39) missense probably benign 0.00
R6502:Btaf1 UTSW 19 36,961,017 (GRCm39) missense probably benign
R7036:Btaf1 UTSW 19 36,981,869 (GRCm39) missense probably benign
R7085:Btaf1 UTSW 19 36,950,318 (GRCm39) missense probably benign
R7097:Btaf1 UTSW 19 36,926,502 (GRCm39) missense probably damaging 1.00
R7248:Btaf1 UTSW 19 36,922,714 (GRCm39) missense possibly damaging 0.54
R7386:Btaf1 UTSW 19 36,935,782 (GRCm39) missense probably benign 0.02
R7402:Btaf1 UTSW 19 36,980,915 (GRCm39) missense probably damaging 1.00
R7452:Btaf1 UTSW 19 36,946,527 (GRCm39) missense probably damaging 1.00
R7493:Btaf1 UTSW 19 36,987,005 (GRCm39) missense probably damaging 1.00
R7513:Btaf1 UTSW 19 36,955,803 (GRCm39) missense probably benign 0.30
R7888:Btaf1 UTSW 19 36,943,036 (GRCm39) missense probably benign 0.10
R7944:Btaf1 UTSW 19 36,926,565 (GRCm39) missense probably benign
R8062:Btaf1 UTSW 19 36,969,865 (GRCm39) missense probably benign 0.00
R8559:Btaf1 UTSW 19 36,964,273 (GRCm39) missense probably benign 0.00
R8793:Btaf1 UTSW 19 36,958,429 (GRCm39) missense probably benign 0.21
R8855:Btaf1 UTSW 19 36,935,901 (GRCm39) missense probably benign
R8866:Btaf1 UTSW 19 36,935,901 (GRCm39) missense probably benign
R9016:Btaf1 UTSW 19 36,971,705 (GRCm39) missense probably benign 0.00
R9028:Btaf1 UTSW 19 36,946,508 (GRCm39) missense probably damaging 1.00
R9109:Btaf1 UTSW 19 36,964,114 (GRCm39) missense probably benign
R9172:Btaf1 UTSW 19 36,977,630 (GRCm39) missense probably damaging 0.98
R9298:Btaf1 UTSW 19 36,964,114 (GRCm39) missense probably benign
R9717:Btaf1 UTSW 19 36,922,646 (GRCm39) missense probably benign 0.28
W0251:Btaf1 UTSW 19 36,980,904 (GRCm39) missense probably damaging 1.00
X0027:Btaf1 UTSW 19 36,926,496 (GRCm39) nonsense probably null
Z1088:Btaf1 UTSW 19 36,964,018 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCCCCAAGTACTAATGGACTG -3'
(R):5'- ACTCTAAGTTGACATGGCAGC -3'

Sequencing Primer
(F):5'- CCCAAGTACTAATGGACTGATATAGG -3'
(R):5'- TTGACATGGCAGCTGAGC -3'
Posted On 2019-05-13