Incidental Mutation 'R7035:Sned1'
ID546579
Institutional Source Beutler Lab
Gene Symbol Sned1
Ensembl Gene ENSMUSG00000047793
Gene Namesushi, nidogen and EGF-like domains 1
Synonyms6720455I24Rik, D430044C15Rik, Snep
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R7035 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location93235841-93301065 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93262130 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 320 (C320R)
Ref Sequence ENSEMBL: ENSMUSP00000050832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062202]
Predicted Effect probably damaging
Transcript: ENSMUST00000062202
AA Change: C320R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050832
Gene: ENSMUSG00000047793
AA Change: C320R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
NIDO 103 260 2.98e-54 SMART
EGF 271 309 3.79e-6 SMART
EGF_CA 311 347 2.42e-13 SMART
EGF 352 385 1.02e-6 SMART
EGF_CA 387 423 1.91e-11 SMART
EGF 432 465 2.96e-8 SMART
EGF 471 500 6.02e0 SMART
EGF 544 577 3.54e-6 SMART
EGF 583 616 6.06e-5 SMART
EGF_CA 619 655 2.33e-6 SMART
EGF 660 693 1.77e-6 SMART
CCP 698 751 2.5e-11 SMART
EGF_CA 753 789 1.66e-11 SMART
EGF_CA 791 827 1.38e-8 SMART
EGF_CA 829 865 1.92e-7 SMART
EGF 870 903 2.35e-2 SMART
FN3 906 991 1.7e-4 SMART
FN3 1005 1084 1.38e-4 SMART
FN3 1104 1185 1.6e-9 SMART
EGF 1309 1342 6.16e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T A 3: 68,869,939 F78I probably benign Het
1700102P08Rik A T 9: 108,395,311 D140V possibly damaging Het
3632451O06Rik T A 14: 49,773,050 H400L possibly damaging Het
6430548M08Rik A T 8: 120,152,486 S208C probably damaging Het
Abcd4 G T 12: 84,615,349 T41K probably damaging Het
Acaca C T 11: 84,238,943 R375C probably damaging Het
Acad11 T A 9: 104,113,495 V433D probably damaging Het
Adal T A 2: 121,155,461 C226S probably benign Het
Aldh3b2 A T 19: 3,978,142 M95L probably benign Het
Ano4 A G 10: 88,954,711 F842S probably damaging Het
Ap5s1 T C 2: 131,212,812 F181S probably damaging Het
Apba1 G A 19: 23,917,567 D456N possibly damaging Het
Atp6v0a1 A C 11: 101,027,357 Q199H probably damaging Het
Atp8a1 C G 5: 67,781,030 G161A probably benign Het
Atxn2 C T 5: 121,811,467 Q61* probably null Het
BC051142 C T 17: 34,460,331 probably benign Het
Cacna2d1 T A 5: 16,246,672 I178K probably damaging Het
Catsperb A C 12: 101,415,334 T92P probably damaging Het
Ccdc175 A G 12: 72,155,645 I292T probably benign Het
Cep290 T A 10: 100,499,071 S318T probably benign Het
Cfb T A 17: 34,860,031 Y826F possibly damaging Het
Cntn1 C A 15: 92,314,511 D851E probably benign Het
Coq6 A G 12: 84,368,641 D146G probably damaging Het
Crem G A 18: 3,327,503 T12I probably damaging Het
Dennd4c G A 4: 86,812,337 V824I probably damaging Het
Dnase2b C T 3: 146,582,341 C333Y probably damaging Het
Dopey1 T A 9: 86,524,302 F365I possibly damaging Het
Dysf A T 6: 84,186,392 I1570F probably benign Het
E330021D16Rik G A 6: 136,401,349 T161M possibly damaging Het
Eml1 T A 12: 108,509,234 C275S probably damaging Het
Fam135b A C 15: 71,462,253 S1031A possibly damaging Het
Gga2 T C 7: 121,989,716 D596G probably damaging Het
Gin1 A C 1: 97,792,375 Y365S possibly damaging Het
Gipr T A 7: 19,162,884 I154F probably damaging Het
Gm5478 A T 15: 101,645,197 I284N possibly damaging Het
Gnat1 A T 9: 107,676,628 probably benign Het
Gsdmc A T 15: 63,778,720 probably null Het
Lama1 T A 17: 67,781,049 I1554N Het
Mycbp2 T A 14: 103,174,981 T2519S probably benign Het
Mylk G A 16: 34,976,982 V1604M possibly damaging Het
Mypop C T 7: 18,991,997 probably benign Het
Nol6 A T 4: 41,118,479 V774E probably benign Het
Nol8 T C 13: 49,661,202 V262A probably benign Het
Npepps A T 11: 97,223,139 V637D probably damaging Het
Olfr1 T C 11: 73,395,718 I101M probably benign Het
Olfr1275 A G 2: 111,231,439 M118T probably damaging Het
Olfr472 T C 7: 107,902,933 V72A probably benign Het
Pcdhgb8 A T 18: 37,763,148 I424F possibly damaging Het
Phf7 A C 14: 31,239,226 W231G probably damaging Het
Plagl1 A G 10: 13,128,233 probably benign Het
Plat A T 8: 22,772,311 D117V probably benign Het
Prkag2 T C 5: 24,947,566 Y180C probably damaging Het
Prpf8 T C 11: 75,504,828 I1927T possibly damaging Het
Ptchd1 T A X: 155,574,712 Y499F probably damaging Het
Rad17 T A 13: 100,627,625 D446V possibly damaging Het
Ralgapa2 G T 2: 146,511,857 Q15K probably damaging Het
Ret A G 6: 118,163,286 Y982H probably damaging Het
Rnf145 T A 11: 44,561,756 S521T probably damaging Het
Samd4 G A 14: 47,089,163 silent Het
Sardh T C 2: 27,230,842 D390G probably damaging Het
Saxo1 T C 4: 86,445,122 T375A probably damaging Het
Scly A G 1: 91,308,403 T126A probably damaging Het
Slc6a16 T A 7: 45,260,827 V307D probably damaging Het
Sspo G A 6: 48,449,213 probably null Het
Sycp2l C T 13: 41,157,497 T645I unknown Het
Tpmt T C 13: 47,040,108 K72E probably damaging Het
Vmn1r51 A T 6: 90,129,225 H41L probably benign Het
Wdfy3 A T 5: 101,855,549 I2900N probably damaging Het
Zfp663 A G 2: 165,353,103 S399P probably benign Het
Zfp692 T C 11: 58,309,442 probably null Het
Other mutations in Sned1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Sned1 APN 1 93274169 splice site probably benign
IGL00955:Sned1 APN 1 93274403 missense probably damaging 1.00
IGL01367:Sned1 APN 1 93283214 missense probably benign 0.32
IGL02116:Sned1 APN 1 93281725 nonsense probably null
IGL02195:Sned1 APN 1 93274160 missense probably benign 0.03
IGL02390:Sned1 APN 1 93261664 missense probably benign
IGL02423:Sned1 APN 1 93283600 missense probably benign
IGL02451:Sned1 APN 1 93236208 splice site probably benign
IGL02567:Sned1 APN 1 93274347 missense probably damaging 0.96
IGL03184:Sned1 APN 1 93274668 missense probably benign 0.01
IGL03328:Sned1 APN 1 93289367 missense probably benign
R0257:Sned1 UTSW 1 93265097 missense possibly damaging 0.75
R0372:Sned1 UTSW 1 93285951 splice site probably benign
R0525:Sned1 UTSW 1 93271974 splice site probably null
R0727:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R0759:Sned1 UTSW 1 93272564 missense probably damaging 1.00
R0965:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R0968:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R0969:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1006:Sned1 UTSW 1 93256392 missense probably damaging 1.00
R1068:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1069:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1070:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1112:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1113:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1114:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1115:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1118:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1119:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1144:Sned1 UTSW 1 93280576 missense probably damaging 0.98
R1228:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1230:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1231:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1313:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1313:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1340:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1382:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1383:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1394:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1395:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1397:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1414:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1430:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1432:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1473:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1503:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1563:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1565:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1689:Sned1 UTSW 1 93283372 missense probably damaging 0.99
R1695:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1734:Sned1 UTSW 1 93259768 missense probably damaging 1.00
R1764:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1767:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1896:Sned1 UTSW 1 93265047 missense probably benign 0.16
R1916:Sned1 UTSW 1 93274162 missense probably null 1.00
R1945:Sned1 UTSW 1 93271238 missense probably benign 0.01
R1972:Sned1 UTSW 1 93265073 missense probably damaging 1.00
R1973:Sned1 UTSW 1 93265073 missense probably damaging 1.00
R2143:Sned1 UTSW 1 93271684 missense probably damaging 1.00
R2144:Sned1 UTSW 1 93271684 missense probably damaging 1.00
R2145:Sned1 UTSW 1 93271684 missense probably damaging 1.00
R2153:Sned1 UTSW 1 93274657 missense probably benign 0.01
R2273:Sned1 UTSW 1 93281642 splice site probably null
R2274:Sned1 UTSW 1 93281642 splice site probably null
R2275:Sned1 UTSW 1 93281642 splice site probably null
R2340:Sned1 UTSW 1 93256452 missense probably damaging 0.98
R3237:Sned1 UTSW 1 93259003 missense probably benign 0.21
R3747:Sned1 UTSW 1 93261751 missense probably damaging 1.00
R3879:Sned1 UTSW 1 93265030 splice site probably benign
R4281:Sned1 UTSW 1 93285855 nonsense probably null
R4282:Sned1 UTSW 1 93285855 nonsense probably null
R4356:Sned1 UTSW 1 93265391 splice site probably null
R4358:Sned1 UTSW 1 93274659 missense probably benign 0.01
R4677:Sned1 UTSW 1 93296297 unclassified probably benign
R5291:Sned1 UTSW 1 93295724 missense possibly damaging 0.80
R5340:Sned1 UTSW 1 93282757 missense probably benign 0.09
R5542:Sned1 UTSW 1 93271602 missense probably benign
R5582:Sned1 UTSW 1 93282361 missense probably damaging 1.00
R5874:Sned1 UTSW 1 93265345 missense probably damaging 1.00
R6159:Sned1 UTSW 1 93282937 missense probably benign 0.00
R6175:Sned1 UTSW 1 93275474 splice site probably null
R6445:Sned1 UTSW 1 93283596 missense possibly damaging 0.89
R6631:Sned1 UTSW 1 93281652 missense probably damaging 1.00
R7018:Sned1 UTSW 1 93284421 missense probably damaging 1.00
R7047:Sned1 UTSW 1 93285818 missense possibly damaging 0.51
R7347:Sned1 UTSW 1 93281736 missense probably damaging 1.00
R7427:Sned1 UTSW 1 93289358 missense probably benign 0.11
R7581:Sned1 UTSW 1 93256545 missense probably benign 0.00
X0025:Sned1 UTSW 1 93261687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCACATGCTTTGGTTATG -3'
(R):5'- TAAGACAGGCCATCCCTCTG -3'

Sequencing Primer
(F):5'- CCACATGCTTTGGTTATGTGGCAG -3'
(R):5'- GGCCATCCCTCTGACATCAG -3'
Posted On2019-05-13