Incidental Mutation 'R7035:Gin1'
ID546580
Institutional Source Beutler Lab
Gene Symbol Gin1
Ensembl Gene ENSMUSG00000026333
Gene Namegypsy retrotransposon integrase 1
Synonyms4930429M06, Zh2c2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7035 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location97770172-97793709 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 97792375 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 365 (Y365S)
Ref Sequence ENSEMBL: ENSMUSP00000027571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027571] [ENSMUST00000112844] [ENSMUST00000138142]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027571
AA Change: Y365S

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027571
Gene: ENSMUSG00000026333
AA Change: Y365S

DomainStartEndE-ValueType
low complexity region 63 73 N/A INTRINSIC
SCOP:d1exqa_ 112 208 2e-5 SMART
low complexity region 254 264 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112844
AA Change: Y454S

PolyPhen 2 Score 0.563 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108464
Gene: ENSMUSG00000026333
AA Change: Y454S

DomainStartEndE-ValueType
low complexity region 63 73 N/A INTRINSIC
PDB:4IKF|B 84 289 3e-8 PDB
SCOP:d1exqa_ 145 297 4e-16 SMART
low complexity region 343 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138142
Predicted Effect probably benign
Transcript: ENSMUST00000159041
SMART Domains Protein: ENSMUSP00000124284
Gene: ENSMUSG00000026335

DomainStartEndE-ValueType
low complexity region 37 44 N/A INTRINSIC
Pfam:NHL 50 78 4.2e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T A 3: 68,869,939 F78I probably benign Het
1700102P08Rik A T 9: 108,395,311 D140V possibly damaging Het
3632451O06Rik T A 14: 49,773,050 H400L possibly damaging Het
6430548M08Rik A T 8: 120,152,486 S208C probably damaging Het
Abcd4 G T 12: 84,615,349 T41K probably damaging Het
Acaca C T 11: 84,238,943 R375C probably damaging Het
Acad11 T A 9: 104,113,495 V433D probably damaging Het
Adal T A 2: 121,155,461 C226S probably benign Het
Aldh3b2 A T 19: 3,978,142 M95L probably benign Het
Ano4 A G 10: 88,954,711 F842S probably damaging Het
Ap5s1 T C 2: 131,212,812 F181S probably damaging Het
Apba1 G A 19: 23,917,567 D456N possibly damaging Het
Atp6v0a1 A C 11: 101,027,357 Q199H probably damaging Het
Atp8a1 C G 5: 67,781,030 G161A probably benign Het
Atxn2 C T 5: 121,811,467 Q61* probably null Het
BC051142 C T 17: 34,460,331 probably benign Het
Cacna2d1 T A 5: 16,246,672 I178K probably damaging Het
Catsperb A C 12: 101,415,334 T92P probably damaging Het
Ccdc175 A G 12: 72,155,645 I292T probably benign Het
Cep290 T A 10: 100,499,071 S318T probably benign Het
Cfb T A 17: 34,860,031 Y826F possibly damaging Het
Cntn1 C A 15: 92,314,511 D851E probably benign Het
Coq6 A G 12: 84,368,641 D146G probably damaging Het
Crem G A 18: 3,327,503 T12I probably damaging Het
Dennd4c G A 4: 86,812,337 V824I probably damaging Het
Dnase2b C T 3: 146,582,341 C333Y probably damaging Het
Dopey1 T A 9: 86,524,302 F365I possibly damaging Het
Dysf A T 6: 84,186,392 I1570F probably benign Het
E330021D16Rik G A 6: 136,401,349 T161M possibly damaging Het
Eml1 T A 12: 108,509,234 C275S probably damaging Het
Fam135b A C 15: 71,462,253 S1031A possibly damaging Het
Gga2 T C 7: 121,989,716 D596G probably damaging Het
Gipr T A 7: 19,162,884 I154F probably damaging Het
Gm5478 A T 15: 101,645,197 I284N possibly damaging Het
Gnat1 A T 9: 107,676,628 probably benign Het
Gsdmc A T 15: 63,778,720 probably null Het
Lama1 T A 17: 67,781,049 I1554N Het
Mycbp2 T A 14: 103,174,981 T2519S probably benign Het
Mylk G A 16: 34,976,982 V1604M possibly damaging Het
Mypop C T 7: 18,991,997 probably benign Het
Nol6 A T 4: 41,118,479 V774E probably benign Het
Nol8 T C 13: 49,661,202 V262A probably benign Het
Npepps A T 11: 97,223,139 V637D probably damaging Het
Olfr1 T C 11: 73,395,718 I101M probably benign Het
Olfr1275 A G 2: 111,231,439 M118T probably damaging Het
Olfr472 T C 7: 107,902,933 V72A probably benign Het
Pcdhgb8 A T 18: 37,763,148 I424F possibly damaging Het
Phf7 A C 14: 31,239,226 W231G probably damaging Het
Plagl1 A G 10: 13,128,233 probably benign Het
Plat A T 8: 22,772,311 D117V probably benign Het
Prkag2 T C 5: 24,947,566 Y180C probably damaging Het
Prpf8 T C 11: 75,504,828 I1927T possibly damaging Het
Ptchd1 T A X: 155,574,712 Y499F probably damaging Het
Rad17 T A 13: 100,627,625 D446V possibly damaging Het
Ralgapa2 G T 2: 146,511,857 Q15K probably damaging Het
Ret A G 6: 118,163,286 Y982H probably damaging Het
Rnf145 T A 11: 44,561,756 S521T probably damaging Het
Samd4 G A 14: 47,089,163 silent Het
Sardh T C 2: 27,230,842 D390G probably damaging Het
Saxo1 T C 4: 86,445,122 T375A probably damaging Het
Scly A G 1: 91,308,403 T126A probably damaging Het
Slc6a16 T A 7: 45,260,827 V307D probably damaging Het
Sned1 T C 1: 93,262,130 C320R probably damaging Het
Sspo G A 6: 48,449,213 probably null Het
Sycp2l C T 13: 41,157,497 T645I unknown Het
Tpmt T C 13: 47,040,108 K72E probably damaging Het
Vmn1r51 A T 6: 90,129,225 H41L probably benign Het
Wdfy3 A T 5: 101,855,549 I2900N probably damaging Het
Zfp663 A G 2: 165,353,103 S399P probably benign Het
Zfp692 T C 11: 58,309,442 probably null Het
Other mutations in Gin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01479:Gin1 APN 1 97792372 missense possibly damaging 0.95
IGL01508:Gin1 APN 1 97777437 missense probably benign
IGL01874:Gin1 APN 1 97783072 missense probably damaging 1.00
R0136:Gin1 UTSW 1 97783016 missense possibly damaging 0.86
R0299:Gin1 UTSW 1 97783016 missense possibly damaging 0.86
R1302:Gin1 UTSW 1 97775589 nonsense probably null
R1607:Gin1 UTSW 1 97786150 missense probably damaging 1.00
R1675:Gin1 UTSW 1 97786055 nonsense probably null
R1739:Gin1 UTSW 1 97786104 missense probably damaging 0.99
R1769:Gin1 UTSW 1 97792437 missense probably benign 0.02
R1817:Gin1 UTSW 1 97785226 splice site probably null
R1818:Gin1 UTSW 1 97785226 splice site probably null
R1819:Gin1 UTSW 1 97785226 splice site probably null
R1907:Gin1 UTSW 1 97775447 unclassified probably benign
R2325:Gin1 UTSW 1 97792561 missense probably damaging 1.00
R4206:Gin1 UTSW 1 97792420 missense possibly damaging 0.90
R4571:Gin1 UTSW 1 97785076 missense probably damaging 1.00
R4576:Gin1 UTSW 1 97792339 missense probably damaging 1.00
R4670:Gin1 UTSW 1 97784840 missense probably damaging 1.00
R4671:Gin1 UTSW 1 97784840 missense probably damaging 1.00
R5659:Gin1 UTSW 1 97775532 missense possibly damaging 0.95
R6360:Gin1 UTSW 1 97792539 missense possibly damaging 0.90
R7229:Gin1 UTSW 1 97785151 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGCGTATGTGTACACAATTTTGTTC -3'
(R):5'- CTCGAGAACTTGATTTGAAGAATCC -3'

Sequencing Primer
(F):5'- AAATTGGTTTCCCGAGCCAG -3'
(R):5'- CCAGTAGGCTAAAAGTCTGTTTCTC -3'
Posted On2019-05-13