Incidental Mutation 'R7035:Sardh'
ID546581
Institutional Source Beutler Lab
Gene Symbol Sardh
Ensembl Gene ENSMUSG00000009614
Gene Namesarcosine dehydrogenase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R7035 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location27188393-27248337 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27230842 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 390 (D390G)
Ref Sequence ENSEMBL: ENSMUSP00000099950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102886]
Predicted Effect probably damaging
Transcript: ENSMUST00000102886
AA Change: D390G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099950
Gene: ENSMUSG00000009614
AA Change: D390G

DomainStartEndE-ValueType
Pfam:DAO 69 428 1.7e-63 PFAM
Pfam:FAO_M 431 486 9.2e-22 PFAM
Pfam:GCV_T 489 799 3.1e-64 PFAM
Pfam:GCV_T_C 807 904 4.7e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme localized to the mitochondrial matrix which catalyzes the oxidative demethylation of sarcosine. This enzyme is distinct from another mitochondrial matrix enzyme, dimethylglycine dehydrogenase, which catalyzes a reaction resulting in the formation of sarcosine. Mutations in this gene are associated with sarcosinemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T A 3: 68,869,939 F78I probably benign Het
1700102P08Rik A T 9: 108,395,311 D140V possibly damaging Het
3632451O06Rik T A 14: 49,773,050 H400L possibly damaging Het
6430548M08Rik A T 8: 120,152,486 S208C probably damaging Het
Abcd4 G T 12: 84,615,349 T41K probably damaging Het
Acaca C T 11: 84,238,943 R375C probably damaging Het
Acad11 T A 9: 104,113,495 V433D probably damaging Het
Adal T A 2: 121,155,461 C226S probably benign Het
Aldh3b2 A T 19: 3,978,142 M95L probably benign Het
Ano4 A G 10: 88,954,711 F842S probably damaging Het
Ap5s1 T C 2: 131,212,812 F181S probably damaging Het
Apba1 G A 19: 23,917,567 D456N possibly damaging Het
Atp6v0a1 A C 11: 101,027,357 Q199H probably damaging Het
Atp8a1 C G 5: 67,781,030 G161A probably benign Het
Atxn2 C T 5: 121,811,467 Q61* probably null Het
BC051142 C T 17: 34,460,331 probably benign Het
Cacna2d1 T A 5: 16,246,672 I178K probably damaging Het
Catsperb A C 12: 101,415,334 T92P probably damaging Het
Ccdc175 A G 12: 72,155,645 I292T probably benign Het
Cep290 T A 10: 100,499,071 S318T probably benign Het
Cfb T A 17: 34,860,031 Y826F possibly damaging Het
Cntn1 C A 15: 92,314,511 D851E probably benign Het
Coq6 A G 12: 84,368,641 D146G probably damaging Het
Crem G A 18: 3,327,503 T12I probably damaging Het
Dennd4c G A 4: 86,812,337 V824I probably damaging Het
Dnase2b C T 3: 146,582,341 C333Y probably damaging Het
Dopey1 T A 9: 86,524,302 F365I possibly damaging Het
Dysf A T 6: 84,186,392 I1570F probably benign Het
E330021D16Rik G A 6: 136,401,349 T161M possibly damaging Het
Eml1 T A 12: 108,509,234 C275S probably damaging Het
Fam135b A C 15: 71,462,253 S1031A possibly damaging Het
Gga2 T C 7: 121,989,716 D596G probably damaging Het
Gin1 A C 1: 97,792,375 Y365S possibly damaging Het
Gipr T A 7: 19,162,884 I154F probably damaging Het
Gm5478 A T 15: 101,645,197 I284N possibly damaging Het
Gnat1 A T 9: 107,676,628 probably benign Het
Gsdmc A T 15: 63,778,720 probably null Het
Lama1 T A 17: 67,781,049 I1554N Het
Mycbp2 T A 14: 103,174,981 T2519S probably benign Het
Mylk G A 16: 34,976,982 V1604M possibly damaging Het
Mypop C T 7: 18,991,997 probably benign Het
Nol6 A T 4: 41,118,479 V774E probably benign Het
Nol8 T C 13: 49,661,202 V262A probably benign Het
Npepps A T 11: 97,223,139 V637D probably damaging Het
Olfr1 T C 11: 73,395,718 I101M probably benign Het
Olfr1275 A G 2: 111,231,439 M118T probably damaging Het
Olfr472 T C 7: 107,902,933 V72A probably benign Het
Pcdhgb8 A T 18: 37,763,148 I424F possibly damaging Het
Phf7 A C 14: 31,239,226 W231G probably damaging Het
Plagl1 A G 10: 13,128,233 probably benign Het
Plat A T 8: 22,772,311 D117V probably benign Het
Prkag2 T C 5: 24,947,566 Y180C probably damaging Het
Prpf8 T C 11: 75,504,828 I1927T possibly damaging Het
Ptchd1 T A X: 155,574,712 Y499F probably damaging Het
Rad17 T A 13: 100,627,625 D446V possibly damaging Het
Ralgapa2 G T 2: 146,511,857 Q15K probably damaging Het
Ret A G 6: 118,163,286 Y982H probably damaging Het
Rnf145 T A 11: 44,561,756 S521T probably damaging Het
Samd4 G A 14: 47,089,163 silent Het
Saxo1 T C 4: 86,445,122 T375A probably damaging Het
Scly A G 1: 91,308,403 T126A probably damaging Het
Slc6a16 T A 7: 45,260,827 V307D probably damaging Het
Sned1 T C 1: 93,262,130 C320R probably damaging Het
Sspo G A 6: 48,449,213 probably null Het
Sycp2l C T 13: 41,157,497 T645I unknown Het
Tpmt T C 13: 47,040,108 K72E probably damaging Het
Vmn1r51 A T 6: 90,129,225 H41L probably benign Het
Wdfy3 A T 5: 101,855,549 I2900N probably damaging Het
Zfp663 A G 2: 165,353,103 S399P probably benign Het
Zfp692 T C 11: 58,309,442 probably null Het
Other mutations in Sardh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Sardh APN 2 27215113 missense probably benign 0.07
IGL01686:Sardh APN 2 27189613 missense probably damaging 1.00
IGL01868:Sardh APN 2 27227147 missense probably benign 0.35
IGL02167:Sardh APN 2 27191975 missense probably damaging 0.98
IGL02272:Sardh APN 2 27224991 missense probably benign 0.00
IGL02870:Sardh APN 2 27235491 missense possibly damaging 0.93
IGL03117:Sardh APN 2 27239446 missense probably damaging 1.00
PIT4305001:Sardh UTSW 2 27228314 missense probably damaging 1.00
PIT4791001:Sardh UTSW 2 27197648 missense probably damaging 1.00
R0265:Sardh UTSW 2 27227066 splice site probably benign
R0781:Sardh UTSW 2 27191919 missense possibly damaging 0.82
R1110:Sardh UTSW 2 27191919 missense possibly damaging 0.82
R1242:Sardh UTSW 2 27235563 missense probably damaging 1.00
R1404:Sardh UTSW 2 27239461 missense probably damaging 1.00
R1404:Sardh UTSW 2 27239461 missense probably damaging 1.00
R1514:Sardh UTSW 2 27197690 missense possibly damaging 0.95
R1565:Sardh UTSW 2 27242719 missense probably damaging 1.00
R1832:Sardh UTSW 2 27235569 missense possibly damaging 0.95
R1836:Sardh UTSW 2 27215182 missense possibly damaging 0.65
R1997:Sardh UTSW 2 27244397 missense probably damaging 0.97
R2006:Sardh UTSW 2 27228339 missense probably damaging 1.00
R2046:Sardh UTSW 2 27215082 missense possibly damaging 0.95
R2242:Sardh UTSW 2 27235515 missense possibly damaging 0.93
R2897:Sardh UTSW 2 27189547 missense probably benign 0.00
R4332:Sardh UTSW 2 27215114 missense possibly damaging 0.85
R4807:Sardh UTSW 2 27189527 missense probably benign 0.00
R4841:Sardh UTSW 2 27191955 missense probably benign 0.09
R4842:Sardh UTSW 2 27191955 missense probably benign 0.09
R4856:Sardh UTSW 2 27244477 missense probably benign 0.02
R4936:Sardh UTSW 2 27228241 splice site probably null
R5089:Sardh UTSW 2 27239613 critical splice donor site probably null
R5110:Sardh UTSW 2 27189547 missense probably benign 0.00
R5257:Sardh UTSW 2 27244259 missense probably damaging 0.98
R5406:Sardh UTSW 2 27211084 missense possibly damaging 0.72
R5450:Sardh UTSW 2 27239698 missense possibly damaging 0.65
R5594:Sardh UTSW 2 27220723 missense probably damaging 1.00
R5870:Sardh UTSW 2 27220641 critical splice donor site probably null
R6014:Sardh UTSW 2 27197528 critical splice donor site probably null
R6021:Sardh UTSW 2 27189643 missense probably benign 0.44
R6470:Sardh UTSW 2 27244372 missense probably damaging 1.00
R6577:Sardh UTSW 2 27218855 missense possibly damaging 0.95
R6750:Sardh UTSW 2 27228257 missense probably benign 0.04
R7162:Sardh UTSW 2 27197690 missense possibly damaging 0.95
R7256:Sardh UTSW 2 27218812 missense probably benign
R7692:Sardh UTSW 2 27197639 missense probably benign 0.01
R7709:Sardh UTSW 2 27241517 missense possibly damaging 0.62
X0011:Sardh UTSW 2 27242746 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGCCTTCTAGCAGGGTTG -3'
(R):5'- ACATAGGTCAAGTGCTTAGGAG -3'

Sequencing Primer
(F):5'- GCACTCTGCACCACACACAG -3'
(R):5'- AGCAATCTGGGAGGCTCC -3'
Posted On2019-05-13