Incidental Mutation 'R7035:Atp8a1'
ID546594
Institutional Source Beutler Lab
Gene Symbol Atp8a1
Ensembl Gene ENSMUSG00000037685
Gene NameATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1
SynonymsB230107D19Rik, Atp3a2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7035 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location67618140-67847434 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 67781030 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Alanine at position 161 (G161A)
Ref Sequence ENSEMBL: ENSMUSP00000144465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037380] [ENSMUST00000072971] [ENSMUST00000113651] [ENSMUST00000113652] [ENSMUST00000135930] [ENSMUST00000200955]
Predicted Effect probably benign
Transcript: ENSMUST00000037380
SMART Domains Protein: ENSMUSP00000042215
Gene: ENSMUSG00000037685

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 9.8e-27 PFAM
Pfam:E1-E2_ATPase 106 371 3e-11 PFAM
Pfam:HAD 406 810 3.8e-23 PFAM
Pfam:Cation_ATPase 485 585 6e-14 PFAM
Pfam:PhoLip_ATPase_C 827 1079 8.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072971
AA Change: G161A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072738
Gene: ENSMUSG00000037685
AA Change: G161A

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 104 375 2.1e-22 PFAM
Pfam:Hydrolase 403 798 2.2e-14 PFAM
Pfam:HAD 406 795 3e-18 PFAM
Pfam:Hydrolase_like2 470 570 4.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113651
SMART Domains Protein: ENSMUSP00000109281
Gene: ENSMUSG00000037685

DomainStartEndE-ValueType
Blast:CUB 46 87 4e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000113652
AA Change: G161A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109282
Gene: ENSMUSG00000037685
AA Change: G161A

DomainStartEndE-ValueType
Blast:CUB 46 87 9e-6 BLAST
Pfam:E1-E2_ATPase 104 175 6.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135930
AA Change: G161A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000118379
Gene: ENSMUSG00000037685
AA Change: G161A

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 1.1e-26 PFAM
Pfam:E1-E2_ATPase 106 371 8.6e-14 PFAM
Pfam:HAD 406 795 3.6e-23 PFAM
Pfam:Cation_ATPase 470 570 1.2e-13 PFAM
Pfam:PhoLip_ATPase_C 812 1064 8.4e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200955
AA Change: G161A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144465
Gene: ENSMUSG00000037685
AA Change: G161A

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 7.5e-25 PFAM
Pfam:E1-E2_ATPase 106 371 3.7e-13 PFAM
Meta Mutation Damage Score 0.0760 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The P-type adenosinetriphosphatases (P-type ATPases) are a family of proteins which use the free energy of ATP hydrolysis to drive uphill transport of ions across membranes. Several subfamilies of P-type ATPases have been identified. One subfamily catalyzes transport of heavy metal ions. Another subfamily transports non-heavy metal ions (NMHI). The protein encoded by this gene is a member of the third subfamily of P-type ATPases and acts to transport amphipaths, such as phosphatidylserine. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable, fertile and phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T A 3: 68,869,939 F78I probably benign Het
1700102P08Rik A T 9: 108,395,311 D140V possibly damaging Het
3632451O06Rik T A 14: 49,773,050 H400L possibly damaging Het
6430548M08Rik A T 8: 120,152,486 S208C probably damaging Het
Abcd4 G T 12: 84,615,349 T41K probably damaging Het
Acaca C T 11: 84,238,943 R375C probably damaging Het
Acad11 T A 9: 104,113,495 V433D probably damaging Het
Adal T A 2: 121,155,461 C226S probably benign Het
Aldh3b2 A T 19: 3,978,142 M95L probably benign Het
Ano4 A G 10: 88,954,711 F842S probably damaging Het
Ap5s1 T C 2: 131,212,812 F181S probably damaging Het
Apba1 G A 19: 23,917,567 D456N possibly damaging Het
Atp6v0a1 A C 11: 101,027,357 Q199H probably damaging Het
Atxn2 C T 5: 121,811,467 Q61* probably null Het
BC051142 C T 17: 34,460,331 probably benign Het
Cacna2d1 T A 5: 16,246,672 I178K probably damaging Het
Catsperb A C 12: 101,415,334 T92P probably damaging Het
Ccdc175 A G 12: 72,155,645 I292T probably benign Het
Cep290 T A 10: 100,499,071 S318T probably benign Het
Cfb T A 17: 34,860,031 Y826F possibly damaging Het
Cntn1 C A 15: 92,314,511 D851E probably benign Het
Coq6 A G 12: 84,368,641 D146G probably damaging Het
Crem G A 18: 3,327,503 T12I probably damaging Het
Dennd4c G A 4: 86,812,337 V824I probably damaging Het
Dnase2b C T 3: 146,582,341 C333Y probably damaging Het
Dopey1 T A 9: 86,524,302 F365I possibly damaging Het
Dysf A T 6: 84,186,392 I1570F probably benign Het
E330021D16Rik G A 6: 136,401,349 T161M possibly damaging Het
Eml1 T A 12: 108,509,234 C275S probably damaging Het
Fam135b A C 15: 71,462,253 S1031A possibly damaging Het
Gga2 T C 7: 121,989,716 D596G probably damaging Het
Gin1 A C 1: 97,792,375 Y365S possibly damaging Het
Gipr T A 7: 19,162,884 I154F probably damaging Het
Gm5478 A T 15: 101,645,197 I284N possibly damaging Het
Gnat1 A T 9: 107,676,628 probably benign Het
Gsdmc A T 15: 63,778,720 probably null Het
Lama1 T A 17: 67,781,049 I1554N Het
Mycbp2 T A 14: 103,174,981 T2519S probably benign Het
Mylk G A 16: 34,976,982 V1604M possibly damaging Het
Mypop C T 7: 18,991,997 probably benign Het
Nol6 A T 4: 41,118,479 V774E probably benign Het
Nol8 T C 13: 49,661,202 V262A probably benign Het
Npepps A T 11: 97,223,139 V637D probably damaging Het
Olfr1 T C 11: 73,395,718 I101M probably benign Het
Olfr1275 A G 2: 111,231,439 M118T probably damaging Het
Olfr472 T C 7: 107,902,933 V72A probably benign Het
Pcdhgb8 A T 18: 37,763,148 I424F possibly damaging Het
Phf7 A C 14: 31,239,226 W231G probably damaging Het
Plagl1 A G 10: 13,128,233 probably benign Het
Plat A T 8: 22,772,311 D117V probably benign Het
Prkag2 T C 5: 24,947,566 Y180C probably damaging Het
Prpf8 T C 11: 75,504,828 I1927T possibly damaging Het
Ptchd1 T A X: 155,574,712 Y499F probably damaging Het
Rad17 T A 13: 100,627,625 D446V possibly damaging Het
Ralgapa2 G T 2: 146,511,857 Q15K probably damaging Het
Ret A G 6: 118,163,286 Y982H probably damaging Het
Rnf145 T A 11: 44,561,756 S521T probably damaging Het
Samd4 G A 14: 47,089,163 silent Het
Sardh T C 2: 27,230,842 D390G probably damaging Het
Saxo1 T C 4: 86,445,122 T375A probably damaging Het
Scly A G 1: 91,308,403 T126A probably damaging Het
Slc6a16 T A 7: 45,260,827 V307D probably damaging Het
Sned1 T C 1: 93,262,130 C320R probably damaging Het
Sspo G A 6: 48,449,213 probably null Het
Sycp2l C T 13: 41,157,497 T645I unknown Het
Tpmt T C 13: 47,040,108 K72E probably damaging Het
Vmn1r51 A T 6: 90,129,225 H41L probably benign Het
Wdfy3 A T 5: 101,855,549 I2900N probably damaging Het
Zfp663 A G 2: 165,353,103 S399P probably benign Het
Zfp692 T C 11: 58,309,442 probably null Het
Other mutations in Atp8a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Atp8a1 APN 5 67749143 missense probably benign 0.20
IGL00778:Atp8a1 APN 5 67659903 missense possibly damaging 0.58
IGL01068:Atp8a1 APN 5 67667337 missense probably benign 0.02
IGL01152:Atp8a1 APN 5 67847206 missense probably damaging 0.99
IGL01572:Atp8a1 APN 5 67667651 missense probably benign
IGL01608:Atp8a1 APN 5 67813136 nonsense probably null
IGL02171:Atp8a1 APN 5 67738465 missense probably damaging 1.00
IGL02330:Atp8a1 APN 5 67813177 missense probably damaging 0.98
IGL02381:Atp8a1 APN 5 67705995 missense probably benign
IGL02420:Atp8a1 APN 5 67682783 missense probably damaging 1.00
IGL02440:Atp8a1 APN 5 67667434 splice site probably benign
IGL02598:Atp8a1 APN 5 67682756 critical splice donor site probably null
IGL03259:Atp8a1 APN 5 67624006 splice site probably null
IGL03336:Atp8a1 APN 5 67729807 nonsense probably null
IGL03380:Atp8a1 APN 5 67732186 missense probably benign 0.25
PIT4131001:Atp8a1 UTSW 5 67622602 nonsense probably null
PIT4445001:Atp8a1 UTSW 5 67622660 missense
R0208:Atp8a1 UTSW 5 67774721 critical splice donor site probably null
R0276:Atp8a1 UTSW 5 67786673 splice site probably benign
R0279:Atp8a1 UTSW 5 67813092 splice site probably null
R0329:Atp8a1 UTSW 5 67812073 splice site probably benign
R0603:Atp8a1 UTSW 5 67756696 critical splice acceptor site probably null
R0715:Atp8a1 UTSW 5 67774725 missense probably benign 0.00
R0763:Atp8a1 UTSW 5 67659883 missense probably benign
R1296:Atp8a1 UTSW 5 67622706 splice site probably benign
R1631:Atp8a1 UTSW 5 67749052 splice site probably null
R1764:Atp8a1 UTSW 5 67631567 missense probably benign 0.14
R1771:Atp8a1 UTSW 5 67647731 missense probably damaging 1.00
R1885:Atp8a1 UTSW 5 67747318 missense possibly damaging 0.82
R1897:Atp8a1 UTSW 5 67738429 missense probably damaging 1.00
R1968:Atp8a1 UTSW 5 67667657 missense probably benign 0.05
R2965:Atp8a1 UTSW 5 67647706 missense probably benign 0.28
R2966:Atp8a1 UTSW 5 67647706 missense probably benign 0.28
R4247:Atp8a1 UTSW 5 67667574 missense probably damaging 1.00
R4353:Atp8a1 UTSW 5 67769108 missense probably damaging 1.00
R4400:Atp8a1 UTSW 5 67764878 missense probably benign 0.13
R4426:Atp8a1 UTSW 5 67774828 missense probably benign 0.22
R4523:Atp8a1 UTSW 5 67667600 missense probably benign 0.00
R4576:Atp8a1 UTSW 5 67815815 intron probably benign
R4622:Atp8a1 UTSW 5 67682713 intron probably benign
R4639:Atp8a1 UTSW 5 67655974 missense probably benign 0.36
R4664:Atp8a1 UTSW 5 67762586 missense possibly damaging 0.92
R4732:Atp8a1 UTSW 5 67813120 missense probably benign 0.07
R4733:Atp8a1 UTSW 5 67813120 missense probably benign 0.07
R5071:Atp8a1 UTSW 5 67815723 missense probably benign 0.29
R5267:Atp8a1 UTSW 5 67762544 missense probably damaging 1.00
R5314:Atp8a1 UTSW 5 67705905 critical splice donor site probably null
R5424:Atp8a1 UTSW 5 67812100 missense probably damaging 1.00
R5588:Atp8a1 UTSW 5 67814684 missense probably damaging 1.00
R5698:Atp8a1 UTSW 5 67767153 missense probably benign 0.14
R5815:Atp8a1 UTSW 5 67749071 missense probably benign 0.00
R5977:Atp8a1 UTSW 5 67747285 missense possibly damaging 0.94
R6285:Atp8a1 UTSW 5 67667607 missense possibly damaging 0.68
R6341:Atp8a1 UTSW 5 67682927 missense possibly damaging 0.88
R6736:Atp8a1 UTSW 5 67667617 missense probably damaging 1.00
R6746:Atp8a1 UTSW 5 67751049 missense probably benign 0.00
R6887:Atp8a1 UTSW 5 67738451 missense probably benign 0.21
R6946:Atp8a1 UTSW 5 67622625 missense possibly damaging 0.50
R6970:Atp8a1 UTSW 5 67738462 missense probably damaging 1.00
R7218:Atp8a1 UTSW 5 67702981 missense
R7278:Atp8a1 UTSW 5 67624037 missense
R7530:Atp8a1 UTSW 5 67745628 missense
R7548:Atp8a1 UTSW 5 67815728 nonsense probably null
R7594:Atp8a1 UTSW 5 67651592 missense
R7722:Atp8a1 UTSW 5 67622698 critical splice acceptor site probably null
R8152:Atp8a1 UTSW 5 67762582 missense
X0019:Atp8a1 UTSW 5 67749141 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GGCCAATCAGTTTTGTAAATGC -3'
(R):5'- AGAGCATCTAAGAAGTTGAGATGTC -3'

Sequencing Primer
(F):5'- AGGGTAGAGAAACCATCC -3'
(R):5'- GAAGTTGAGATGTCAATCAAACATG -3'
Posted On2019-05-13