Incidental Mutation 'R7035:Gnat1'
ID546610
Institutional Source Beutler Lab
Gene Symbol Gnat1
Ensembl Gene ENSMUSG00000034837
Gene Nameguanine nucleotide binding protein, alpha transducing 1
SynonymsGnat-1, Ird1, irdr, Ird2, transducin, Tralpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.293) question?
Stock #R7035 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location107674474-107679712 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 107676628 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010205] [ENSMUST00000080560] [ENSMUST00000192271]
Predicted Effect
SMART Domains Protein: ENSMUSP00000010205
Gene: ENSMUSG00000034837
AA Change: I208N

DomainStartEndE-ValueType
G_alpha 9 349 5.13e-223 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080560
SMART Domains Protein: ENSMUSP00000079400
Gene: ENSMUSG00000034684

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 57 498 5.46e-206 SMART
PSI 516 568 1.87e-12 SMART
IGc2 586 654 3.79e-4 SMART
low complexity region 673 695 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192271
SMART Domains Protein: ENSMUSP00000141571
Gene: ENSMUSG00000034837

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
transmembrane domain 32 49 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transducin is a 3-subunit guanine nucleotide-binding protein (G protein) which stimulates the coupling of rhodopsin and cGMP-phoshodiesterase during visual impulses. The transducin alpha subunits in rods and cones are encoded by separate genes. This gene encodes the alpha subunit in rods. This gene is also expressed in other cells, and has been implicated in bitter taste transduction in rat taste cells. Mutations in this gene result in autosomal dominant congenital stationary night blindness. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for disruption of this gene display retinal degeneration with age and abnormal electrophysiology of the rods. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T A 3: 68,869,939 F78I probably benign Het
1700102P08Rik A T 9: 108,395,311 D140V possibly damaging Het
3632451O06Rik T A 14: 49,773,050 H400L possibly damaging Het
6430548M08Rik A T 8: 120,152,486 S208C probably damaging Het
Abcd4 G T 12: 84,615,349 T41K probably damaging Het
Acaca C T 11: 84,238,943 R375C probably damaging Het
Acad11 T A 9: 104,113,495 V433D probably damaging Het
Adal T A 2: 121,155,461 C226S probably benign Het
Aldh3b2 A T 19: 3,978,142 M95L probably benign Het
Ano4 A G 10: 88,954,711 F842S probably damaging Het
Ap5s1 T C 2: 131,212,812 F181S probably damaging Het
Apba1 G A 19: 23,917,567 D456N possibly damaging Het
Atp6v0a1 A C 11: 101,027,357 Q199H probably damaging Het
Atp8a1 C G 5: 67,781,030 G161A probably benign Het
Atxn2 C T 5: 121,811,467 Q61* probably null Het
BC051142 C T 17: 34,460,331 probably benign Het
Cacna2d1 T A 5: 16,246,672 I178K probably damaging Het
Catsperb A C 12: 101,415,334 T92P probably damaging Het
Ccdc175 A G 12: 72,155,645 I292T probably benign Het
Cep290 T A 10: 100,499,071 S318T probably benign Het
Cfb T A 17: 34,860,031 Y826F possibly damaging Het
Cntn1 C A 15: 92,314,511 D851E probably benign Het
Coq6 A G 12: 84,368,641 D146G probably damaging Het
Crem G A 18: 3,327,503 T12I probably damaging Het
Dennd4c G A 4: 86,812,337 V824I probably damaging Het
Dnase2b C T 3: 146,582,341 C333Y probably damaging Het
Dopey1 T A 9: 86,524,302 F365I possibly damaging Het
Dysf A T 6: 84,186,392 I1570F probably benign Het
E330021D16Rik G A 6: 136,401,349 T161M possibly damaging Het
Eml1 T A 12: 108,509,234 C275S probably damaging Het
Fam135b A C 15: 71,462,253 S1031A possibly damaging Het
Gga2 T C 7: 121,989,716 D596G probably damaging Het
Gin1 A C 1: 97,792,375 Y365S possibly damaging Het
Gipr T A 7: 19,162,884 I154F probably damaging Het
Gm5478 A T 15: 101,645,197 I284N possibly damaging Het
Gsdmc A T 15: 63,778,720 probably null Het
Lama1 T A 17: 67,781,049 I1554N Het
Mycbp2 T A 14: 103,174,981 T2519S probably benign Het
Mylk G A 16: 34,976,982 V1604M possibly damaging Het
Mypop C T 7: 18,991,997 probably benign Het
Nol6 A T 4: 41,118,479 V774E probably benign Het
Nol8 T C 13: 49,661,202 V262A probably benign Het
Npepps A T 11: 97,223,139 V637D probably damaging Het
Olfr1 T C 11: 73,395,718 I101M probably benign Het
Olfr1275 A G 2: 111,231,439 M118T probably damaging Het
Olfr472 T C 7: 107,902,933 V72A probably benign Het
Pcdhgb8 A T 18: 37,763,148 I424F possibly damaging Het
Phf7 A C 14: 31,239,226 W231G probably damaging Het
Plagl1 A G 10: 13,128,233 probably benign Het
Plat A T 8: 22,772,311 D117V probably benign Het
Prkag2 T C 5: 24,947,566 Y180C probably damaging Het
Prpf8 T C 11: 75,504,828 I1927T possibly damaging Het
Ptchd1 T A X: 155,574,712 Y499F probably damaging Het
Rad17 T A 13: 100,627,625 D446V possibly damaging Het
Ralgapa2 G T 2: 146,511,857 Q15K probably damaging Het
Ret A G 6: 118,163,286 Y982H probably damaging Het
Rnf145 T A 11: 44,561,756 S521T probably damaging Het
Samd4 G A 14: 47,089,163 silent Het
Sardh T C 2: 27,230,842 D390G probably damaging Het
Saxo1 T C 4: 86,445,122 T375A probably damaging Het
Scly A G 1: 91,308,403 T126A probably damaging Het
Slc6a16 T A 7: 45,260,827 V307D probably damaging Het
Sned1 T C 1: 93,262,130 C320R probably damaging Het
Sspo G A 6: 48,449,213 probably null Het
Sycp2l C T 13: 41,157,497 T645I unknown Het
Tpmt T C 13: 47,040,108 K72E probably damaging Het
Vmn1r51 A T 6: 90,129,225 H41L probably benign Het
Wdfy3 A T 5: 101,855,549 I2900N probably damaging Het
Zfp663 A G 2: 165,353,103 S399P probably benign Het
Zfp692 T C 11: 58,309,442 probably null Het
Other mutations in Gnat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Gnat1 APN 9 107679434 unclassified probably null
IGL01514:Gnat1 APN 9 107676301 missense possibly damaging 0.56
R0730:Gnat1 UTSW 9 107679463 missense probably damaging 1.00
R1054:Gnat1 UTSW 9 107677439 missense probably damaging 1.00
R1268:Gnat1 UTSW 9 107675877 unclassified probably benign
R1440:Gnat1 UTSW 9 107676965 missense probably damaging 1.00
R1824:Gnat1 UTSW 9 107676575 missense probably damaging 1.00
R4964:Gnat1 UTSW 9 107677234 missense probably benign 0.05
R4966:Gnat1 UTSW 9 107677234 missense probably benign 0.05
R6355:Gnat1 UTSW 9 107677424 missense probably benign 0.03
R7218:Gnat1 UTSW 9 107675985 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TCTGTTCCGTGAGTCTCACTGG -3'
(R):5'- TGAGTGAAGGTCCTTGCCAG -3'

Sequencing Primer
(F):5'- GTGAGTCTCACTGGCTCCCAC -3'
(R):5'- GTCATTTCAGATGCCAAGCG -3'
Posted On2019-05-13