Incidental Mutation 'R7035:Atp6v0a1'
ID546621
Institutional Source Beutler Lab
Gene Symbol Atp6v0a1
Ensembl Gene ENSMUSG00000019302
Gene NameATPase, H+ transporting, lysosomal V0 subunit A1
SynonymsAtp6n1a, Vpp-1, Vpp1, V-ATPase a1, Atp6n1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7035 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location101009452-101063719 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 101027357 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 199 (Q199H)
Ref Sequence ENSEMBL: ENSMUSP00000131848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044721] [ENSMUST00000092663] [ENSMUST00000103110] [ENSMUST00000168757]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044721
AA Change: Q199H

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000044838
Gene: ENSMUSG00000019302
AA Change: Q199H

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 829 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000092663
AA Change: Q199H

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000090333
Gene: ENSMUSG00000019302
AA Change: Q199H

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 823 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103110
AA Change: Q206H

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000099399
Gene: ENSMUSG00000019302
AA Change: Q206H

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 829 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168757
AA Change: Q199H

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131848
Gene: ENSMUSG00000019302
AA Change: Q199H

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 829 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This gene encodes one of three A subunit proteins and the encoded protein is associated with clathrin-coated vesicles. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T A 3: 68,869,939 F78I probably benign Het
1700102P08Rik A T 9: 108,395,311 D140V possibly damaging Het
3632451O06Rik T A 14: 49,773,050 H400L possibly damaging Het
6430548M08Rik A T 8: 120,152,486 S208C probably damaging Het
Abcd4 G T 12: 84,615,349 T41K probably damaging Het
Acaca C T 11: 84,238,943 R375C probably damaging Het
Acad11 T A 9: 104,113,495 V433D probably damaging Het
Adal T A 2: 121,155,461 C226S probably benign Het
Aldh3b2 A T 19: 3,978,142 M95L probably benign Het
Ano4 A G 10: 88,954,711 F842S probably damaging Het
Ap5s1 T C 2: 131,212,812 F181S probably damaging Het
Apba1 G A 19: 23,917,567 D456N possibly damaging Het
Atp8a1 C G 5: 67,781,030 G161A probably benign Het
Atxn2 C T 5: 121,811,467 Q61* probably null Het
BC051142 C T 17: 34,460,331 probably benign Het
Cacna2d1 T A 5: 16,246,672 I178K probably damaging Het
Catsperb A C 12: 101,415,334 T92P probably damaging Het
Ccdc175 A G 12: 72,155,645 I292T probably benign Het
Cep290 T A 10: 100,499,071 S318T probably benign Het
Cfb T A 17: 34,860,031 Y826F possibly damaging Het
Cntn1 C A 15: 92,314,511 D851E probably benign Het
Coq6 A G 12: 84,368,641 D146G probably damaging Het
Crem G A 18: 3,327,503 T12I probably damaging Het
Dennd4c G A 4: 86,812,337 V824I probably damaging Het
Dnase2b C T 3: 146,582,341 C333Y probably damaging Het
Dopey1 T A 9: 86,524,302 F365I possibly damaging Het
Dysf A T 6: 84,186,392 I1570F probably benign Het
E330021D16Rik G A 6: 136,401,349 T161M possibly damaging Het
Eml1 T A 12: 108,509,234 C275S probably damaging Het
Fam135b A C 15: 71,462,253 S1031A possibly damaging Het
Gga2 T C 7: 121,989,716 D596G probably damaging Het
Gin1 A C 1: 97,792,375 Y365S possibly damaging Het
Gipr T A 7: 19,162,884 I154F probably damaging Het
Gm5478 A T 15: 101,645,197 I284N possibly damaging Het
Gnat1 A T 9: 107,676,628 probably benign Het
Gsdmc A T 15: 63,778,720 probably null Het
Lama1 T A 17: 67,781,049 I1554N Het
Mycbp2 T A 14: 103,174,981 T2519S probably benign Het
Mylk G A 16: 34,976,982 V1604M possibly damaging Het
Mypop C T 7: 18,991,997 probably benign Het
Nol6 A T 4: 41,118,479 V774E probably benign Het
Nol8 T C 13: 49,661,202 V262A probably benign Het
Npepps A T 11: 97,223,139 V637D probably damaging Het
Olfr1 T C 11: 73,395,718 I101M probably benign Het
Olfr1275 A G 2: 111,231,439 M118T probably damaging Het
Olfr472 T C 7: 107,902,933 V72A probably benign Het
Pcdhgb8 A T 18: 37,763,148 I424F possibly damaging Het
Phf7 A C 14: 31,239,226 W231G probably damaging Het
Plagl1 A G 10: 13,128,233 probably benign Het
Plat A T 8: 22,772,311 D117V probably benign Het
Prkag2 T C 5: 24,947,566 Y180C probably damaging Het
Prpf8 T C 11: 75,504,828 I1927T possibly damaging Het
Ptchd1 T A X: 155,574,712 Y499F probably damaging Het
Rad17 T A 13: 100,627,625 D446V possibly damaging Het
Ralgapa2 G T 2: 146,511,857 Q15K probably damaging Het
Ret A G 6: 118,163,286 Y982H probably damaging Het
Rnf145 T A 11: 44,561,756 S521T probably damaging Het
Samd4 G A 14: 47,089,163 silent Het
Sardh T C 2: 27,230,842 D390G probably damaging Het
Saxo1 T C 4: 86,445,122 T375A probably damaging Het
Scly A G 1: 91,308,403 T126A probably damaging Het
Slc6a16 T A 7: 45,260,827 V307D probably damaging Het
Sned1 T C 1: 93,262,130 C320R probably damaging Het
Sspo G A 6: 48,449,213 probably null Het
Sycp2l C T 13: 41,157,497 T645I unknown Het
Tpmt T C 13: 47,040,108 K72E probably damaging Het
Vmn1r51 A T 6: 90,129,225 H41L probably benign Het
Wdfy3 A T 5: 101,855,549 I2900N probably damaging Het
Zfp663 A G 2: 165,353,103 S399P probably benign Het
Zfp692 T C 11: 58,309,442 probably null Het
Other mutations in Atp6v0a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:Atp6v0a1 APN 11 101030505 critical splice donor site probably null
IGL01024:Atp6v0a1 APN 11 101048439 missense probably benign 0.00
IGL01390:Atp6v0a1 APN 11 101043802 missense probably benign 0.01
IGL02214:Atp6v0a1 APN 11 101039840 missense probably benign 0.01
IGL02639:Atp6v0a1 APN 11 101055518 missense possibly damaging 0.90
R0125:Atp6v0a1 UTSW 11 101038851 splice site probably null
R0193:Atp6v0a1 UTSW 11 101048482 missense possibly damaging 0.90
R0265:Atp6v0a1 UTSW 11 101048515 missense possibly damaging 0.80
R0973:Atp6v0a1 UTSW 11 101055491 nonsense probably null
R0973:Atp6v0a1 UTSW 11 101055491 nonsense probably null
R0974:Atp6v0a1 UTSW 11 101055491 nonsense probably null
R1460:Atp6v0a1 UTSW 11 101033998 missense probably damaging 1.00
R1580:Atp6v0a1 UTSW 11 101029204 missense probably damaging 1.00
R1625:Atp6v0a1 UTSW 11 101055554 missense probably damaging 1.00
R1644:Atp6v0a1 UTSW 11 101038786 missense possibly damaging 0.65
R1779:Atp6v0a1 UTSW 11 101026685 missense probably benign 0.01
R2895:Atp6v0a1 UTSW 11 101044598 missense probably benign
R2926:Atp6v0a1 UTSW 11 101043948 missense probably damaging 0.99
R3727:Atp6v0a1 UTSW 11 101030420 missense probably benign 0.01
R3943:Atp6v0a1 UTSW 11 101055517 missense probably benign 0.00
R4820:Atp6v0a1 UTSW 11 101042950 missense probably benign 0.00
R5119:Atp6v0a1 UTSW 11 101020515 missense probably benign 0.02
R5250:Atp6v0a1 UTSW 11 101043044 missense possibly damaging 0.94
R5377:Atp6v0a1 UTSW 11 101055587 missense probably damaging 1.00
R5393:Atp6v0a1 UTSW 11 101038807 missense possibly damaging 0.95
R5497:Atp6v0a1 UTSW 11 101029185 missense probably damaging 1.00
R5787:Atp6v0a1 UTSW 11 101018574 missense probably benign 0.04
R6054:Atp6v0a1 UTSW 11 101039889 missense possibly damaging 0.91
R6076:Atp6v0a1 UTSW 11 101055060 missense probably damaging 1.00
R6889:Atp6v0a1 UTSW 11 101029183 missense possibly damaging 0.87
R7084:Atp6v0a1 UTSW 11 101034042 missense probably damaging 1.00
R7212:Atp6v0a1 UTSW 11 101043957 missense probably benign 0.08
X0023:Atp6v0a1 UTSW 11 101044597 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTGTGCAGTGTACAATCTTTCC -3'
(R):5'- ATGCTGTGTCTACATATGTGCG -3'

Sequencing Primer
(F):5'- GTGCAGTGTACAATCTTTCCTCTTTC -3'
(R):5'- TCTACATATGTGCGGACATGG -3'
Posted On2019-05-13