Incidental Mutation 'R7035:Coq6'
ID546623
Institutional Source Beutler Lab
Gene Symbol Coq6
Ensembl Gene ENSMUSG00000021235
Gene Namecoenzyme Q6 monooxygenase
Synonyms5930427M12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7035 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location84361657-84373796 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84368641 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 146 (D146G)
Ref Sequence ENSEMBL: ENSMUSP00000105907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021661] [ENSMUST00000110276] [ENSMUST00000110278] [ENSMUST00000152913]
Predicted Effect probably damaging
Transcript: ENSMUST00000021661
AA Change: D146G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021661
Gene: ENSMUSG00000021235
AA Change: D146G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
Pfam:FAD_binding_3 195 328 3.9e-8 PFAM
Pfam:FAD_binding_3 334 435 1.3e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110276
AA Change: D146G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105905
Gene: ENSMUSG00000021235
AA Change: D146G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
Pfam:FAD_binding_3 195 328 5.1e-8 PFAM
Pfam:FAD_binding_3 334 435 1.7e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110278
AA Change: D146G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105907
Gene: ENSMUSG00000021235
AA Change: D146G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
Pfam:FAD_binding_3 195 328 6.8e-8 PFAM
Pfam:FAD_binding_3 334 410 1.1e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000145522
AA Change: D141G

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117609
Gene: ENSMUSG00000021235
AA Change: D141G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SCOP:d1foha5 35 167 2e-6 SMART
PDB:4K22|B 90 156 3e-8 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000152913
AA Change: D146G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115676
Gene: ENSMUSG00000021235
AA Change: D146G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1foha5 39 269 1e-10 SMART
PDB:4K22|B 94 274 1e-20 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ubiH/COQ6 family. It is an evolutionarily conserved monooxygenase required for the biosynthesis of coenzyme Q10 (or ubiquinone), which is an essential component of the mitochondrial electron transport chain, and one of the most potent lipophilic antioxidants implicated in the protection of cell damage by reactive oxygen species. Knockdown of this gene in mouse and zebrafish results in decreased growth due to increased apoptosis. Mutations in this gene are associated with autosomal recessive coenzyme Q10 deficiency-6 (COQ10D6), which manifests as nephrotic syndrome with sensorineural deafness. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T A 3: 68,869,939 F78I probably benign Het
1700102P08Rik A T 9: 108,395,311 D140V possibly damaging Het
3632451O06Rik T A 14: 49,773,050 H400L possibly damaging Het
6430548M08Rik A T 8: 120,152,486 S208C probably damaging Het
Abcd4 G T 12: 84,615,349 T41K probably damaging Het
Acaca C T 11: 84,238,943 R375C probably damaging Het
Acad11 T A 9: 104,113,495 V433D probably damaging Het
Adal T A 2: 121,155,461 C226S probably benign Het
Aldh3b2 A T 19: 3,978,142 M95L probably benign Het
Ano4 A G 10: 88,954,711 F842S probably damaging Het
Ap5s1 T C 2: 131,212,812 F181S probably damaging Het
Apba1 G A 19: 23,917,567 D456N possibly damaging Het
Atp6v0a1 A C 11: 101,027,357 Q199H probably damaging Het
Atp8a1 C G 5: 67,781,030 G161A probably benign Het
Atxn2 C T 5: 121,811,467 Q61* probably null Het
BC051142 C T 17: 34,460,331 probably benign Het
Cacna2d1 T A 5: 16,246,672 I178K probably damaging Het
Catsperb A C 12: 101,415,334 T92P probably damaging Het
Ccdc175 A G 12: 72,155,645 I292T probably benign Het
Cep290 T A 10: 100,499,071 S318T probably benign Het
Cfb T A 17: 34,860,031 Y826F possibly damaging Het
Cntn1 C A 15: 92,314,511 D851E probably benign Het
Crem G A 18: 3,327,503 T12I probably damaging Het
Dennd4c G A 4: 86,812,337 V824I probably damaging Het
Dnase2b C T 3: 146,582,341 C333Y probably damaging Het
Dopey1 T A 9: 86,524,302 F365I possibly damaging Het
Dysf A T 6: 84,186,392 I1570F probably benign Het
E330021D16Rik G A 6: 136,401,349 T161M possibly damaging Het
Eml1 T A 12: 108,509,234 C275S probably damaging Het
Fam135b A C 15: 71,462,253 S1031A possibly damaging Het
Gga2 T C 7: 121,989,716 D596G probably damaging Het
Gin1 A C 1: 97,792,375 Y365S possibly damaging Het
Gipr T A 7: 19,162,884 I154F probably damaging Het
Gm5478 A T 15: 101,645,197 I284N possibly damaging Het
Gnat1 A T 9: 107,676,628 probably benign Het
Gsdmc A T 15: 63,778,720 probably null Het
Lama1 T A 17: 67,781,049 I1554N Het
Mycbp2 T A 14: 103,174,981 T2519S probably benign Het
Mylk G A 16: 34,976,982 V1604M possibly damaging Het
Mypop C T 7: 18,991,997 probably benign Het
Nol6 A T 4: 41,118,479 V774E probably benign Het
Nol8 T C 13: 49,661,202 V262A probably benign Het
Npepps A T 11: 97,223,139 V637D probably damaging Het
Olfr1 T C 11: 73,395,718 I101M probably benign Het
Olfr1275 A G 2: 111,231,439 M118T probably damaging Het
Olfr472 T C 7: 107,902,933 V72A probably benign Het
Pcdhgb8 A T 18: 37,763,148 I424F possibly damaging Het
Phf7 A C 14: 31,239,226 W231G probably damaging Het
Plagl1 A G 10: 13,128,233 probably benign Het
Plat A T 8: 22,772,311 D117V probably benign Het
Prkag2 T C 5: 24,947,566 Y180C probably damaging Het
Prpf8 T C 11: 75,504,828 I1927T possibly damaging Het
Ptchd1 T A X: 155,574,712 Y499F probably damaging Het
Rad17 T A 13: 100,627,625 D446V possibly damaging Het
Ralgapa2 G T 2: 146,511,857 Q15K probably damaging Het
Ret A G 6: 118,163,286 Y982H probably damaging Het
Rnf145 T A 11: 44,561,756 S521T probably damaging Het
Samd4 G A 14: 47,089,163 silent Het
Sardh T C 2: 27,230,842 D390G probably damaging Het
Saxo1 T C 4: 86,445,122 T375A probably damaging Het
Scly A G 1: 91,308,403 T126A probably damaging Het
Slc6a16 T A 7: 45,260,827 V307D probably damaging Het
Sned1 T C 1: 93,262,130 C320R probably damaging Het
Sspo G A 6: 48,449,213 probably null Het
Sycp2l C T 13: 41,157,497 T645I unknown Het
Tpmt T C 13: 47,040,108 K72E probably damaging Het
Vmn1r51 A T 6: 90,129,225 H41L probably benign Het
Wdfy3 A T 5: 101,855,549 I2900N probably damaging Het
Zfp663 A G 2: 165,353,103 S399P probably benign Het
Zfp692 T C 11: 58,309,442 probably null Het
Other mutations in Coq6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0508:Coq6 UTSW 12 84368139 splice site probably benign
R0607:Coq6 UTSW 12 84368638 missense possibly damaging 0.95
R1221:Coq6 UTSW 12 84371527 missense possibly damaging 0.96
R1885:Coq6 UTSW 12 84372464 missense probably damaging 1.00
R1898:Coq6 UTSW 12 84366963 missense probably benign 0.38
R3153:Coq6 UTSW 12 84371535 missense probably damaging 1.00
R3824:Coq6 UTSW 12 84372415 splice site probably benign
R4015:Coq6 UTSW 12 84366897 missense probably benign 0.00
R4241:Coq6 UTSW 12 84373789 utr 3 prime probably benign
R4285:Coq6 UTSW 12 84370404 intron probably benign
R4353:Coq6 UTSW 12 84368149 missense probably damaging 0.99
R4598:Coq6 UTSW 12 84362139 missense probably benign 0.00
R4599:Coq6 UTSW 12 84362139 missense probably benign 0.00
R4868:Coq6 UTSW 12 84370952 missense probably damaging 0.99
R4887:Coq6 UTSW 12 84372296 missense probably damaging 1.00
R5567:Coq6 UTSW 12 84368639 missense probably benign 0.10
R5570:Coq6 UTSW 12 84368639 missense probably benign 0.10
R5715:Coq6 UTSW 12 84366907 missense probably benign 0.10
R6608:Coq6 UTSW 12 84372148 missense probably benign 0.00
R7096:Coq6 UTSW 12 84361821 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTCGCTTTATGTCCTGCCAAAG -3'
(R):5'- AGCTCTTATTTGCCAGCCTCAG -3'

Sequencing Primer
(F):5'- AGAGGCGGACAGTCTGTGC -3'
(R):5'- GCCAGCCTCAGCCTCTAC -3'
Posted On2019-05-13