Mutagenetix > Incidental Mutations

Incidental Mutation 'R7036:Kmt2e'

546672

Institutional Source

Beutler Lab

Gene Symbol

Kmt2e

Ensembl Gene

ENSMUSG00000029004

Gene Name

lysine (K)-specific methyltransferase 2E

Synonyms

D230038D11Rik, 9530077A04Rik, 1810033J14Rik, Mll5

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7036 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

23434441-23504235 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 23478743 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 333 (E333G)

Ref Sequence

ENSEMBL: ENSMUSP00000110781 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094962] [ENSMUST00000115128] [ENSMUST00000196889]

Predicted Effect

probably null
Transcript: ENSMUST00000094962
AA Change: E333G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000092569
Gene: ENSMUSG00000029004
AA Change: E333G

Domain	Start	End	E-Value	Type
low complexity region	23	38	N/A	INTRINSIC
low complexity region	48	55	N/A	INTRINSIC
low complexity region	70	81	N/A	INTRINSIC
low complexity region	100	109	N/A	INTRINSIC
PHD	120	164	4.25e-8	SMART
SET	328	453	2.13e-26	SMART
low complexity region	487	503	N/A	INTRINSIC
low complexity region	569	582	N/A	INTRINSIC
low complexity region	854	867	N/A	INTRINSIC
low complexity region	882	908	N/A	INTRINSIC
low complexity region	933	945	N/A	INTRINSIC
low complexity region	951	960	N/A	INTRINSIC
low complexity region	1184	1197	N/A	INTRINSIC
low complexity region	1214	1237	N/A	INTRINSIC
low complexity region	1294	1312	N/A	INTRINSIC
low complexity region	1348	1367	N/A	INTRINSIC
internal_repeat_1	1434	1496	6.13e-7	PROSPERO
low complexity region	1506	1518	N/A	INTRINSIC
low complexity region	1625	1641	N/A	INTRINSIC
low complexity region	1677	1705	N/A	INTRINSIC
low complexity region	1720	1731	N/A	INTRINSIC
internal_repeat_1	1783	1842	6.13e-7	PROSPERO

Predicted Effect

probably null
Transcript: ENSMUST00000115128
AA Change: E333G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110781
Gene: ENSMUSG00000029004
AA Change: E333G

Domain	Start	End	E-Value	Type
low complexity region	23	38	N/A	INTRINSIC
low complexity region	48	55	N/A	INTRINSIC
low complexity region	70	81	N/A	INTRINSIC
low complexity region	100	109	N/A	INTRINSIC
PHD	120	164	4.25e-8	SMART
SET	328	453	2.13e-26	SMART
low complexity region	487	503	N/A	INTRINSIC
low complexity region	569	582	N/A	INTRINSIC
low complexity region	854	867	N/A	INTRINSIC
low complexity region	882	908	N/A	INTRINSIC
low complexity region	933	945	N/A	INTRINSIC
low complexity region	951	960	N/A	INTRINSIC
low complexity region	1184	1197	N/A	INTRINSIC
low complexity region	1214	1237	N/A	INTRINSIC
low complexity region	1294	1312	N/A	INTRINSIC
low complexity region	1348	1367	N/A	INTRINSIC
internal_repeat_1	1434	1496	6.13e-7	PROSPERO
low complexity region	1506	1518	N/A	INTRINSIC
low complexity region	1625	1641	N/A	INTRINSIC
low complexity region	1677	1705	N/A	INTRINSIC
low complexity region	1720	1731	N/A	INTRINSIC
internal_repeat_1	1783	1842	6.13e-7	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000196889
AA Change: E333G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142568
Gene: ENSMUSG00000029004
AA Change: E333G

Domain	Start	End	E-Value	Type
low complexity region	23	38	N/A	INTRINSIC
low complexity region	48	55	N/A	INTRINSIC
low complexity region	70	81	N/A	INTRINSIC
low complexity region	100	109	N/A	INTRINSIC
PHD	120	164	2.7e-10	SMART
Blast:SET	216	327	6e-61	BLAST
Blast:SET	328	377	3e-26	BLAST

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a protein with an N-terminal PHD zinc finger and a central SET domain. Overexpression of the protein inhibits cell cycle progression. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal and postnatal lethality, reduced fertility and growth, and abnormal lymphopoiesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	T	A	10: 100,609,256		probably null	Het
9030624J02Rik	T	C	7: 118,773,092	S290P	probably damaging	Het
9130011E15Rik	A	G	19: 45,965,249	I195T	probably damaging	Het
Ahnak2	A	G	12: 112,778,781		probably benign	Het
Akt2	T	C	7: 27,637,012		probably null	Het
Aldh1a7	A	T	19: 20,708,178	L336Q	possibly damaging	Het
Ank2	T	C	3: 126,946,392		probably benign	Het
Ank3	C	T	10: 69,999,379	T680M	probably damaging	Het
Apeh	T	C	9: 108,094,271	E59G	possibly damaging	Het
Arl8a	G	C	1: 135,154,468	E145Q	probably benign	Het
Armc8	C	T	9: 99,483,965		probably null	Het
Arsj	T	C	3: 126,365,000	L76P	probably damaging	Het
Atp2b1	C	T	10: 98,987,310	T244I	probably damaging	Het
Bcl6	A	T	16: 23,974,861	L112Q	probably damaging	Het
Bfsp1	T	A	2: 143,826,923	T579S	possibly damaging	Het
Btaf1	C	A	19: 37,004,469	T1633K	probably benign	Het
Cacng8	A	G	7: 3,415,303	S324G	probably benign	Het
Cd2ap	A	T	17: 42,798,599	L623Q	probably damaging	Het
Cerkl	T	C	2: 79,341,378	I379V	probably benign	Het
Cndp2	T	A	18: 84,669,945	H307L	possibly damaging	Het
Derl1	A	G	15: 57,879,047		probably null	Het
Dixdc1	T	A	9: 50,682,564	R254S	probably benign	Het
Dopey2	T	A	16: 93,777,490	D30E	probably benign	Het
Duox2	T	G	2: 122,280,453	H1513P	probably damaging	Het
Dyrk1a	G	A	16: 94,686,568	V546I	probably benign	Het
E130308A19Rik	A	C	4: 59,719,991	K508Q	probably damaging	Het
Emc8	A	T	8: 120,659,051	V108E	probably benign	Het
Epb41l1	A	G	2: 156,529,402	T720A	probably benign	Het
Fam126b	T	A	1: 58,535,537	M282L	probably benign	Het
Fam71b	G	A	11: 46,407,408	S513N		Het
Fcgr4	T	A	1: 171,020,088	M85K	probably benign	Het
Fem1b	T	A	9: 62,797,028	I317F	probably damaging	Het
Focad	A	G	4: 88,124,637	E36G	probably benign	Het
Fryl	C	T	5: 73,055,608	E2275K	probably benign	Het
Galnt11	T	C	5: 25,258,813	I361T	probably damaging	Het
Gatad2a	A	T	8: 69,917,994	N114K	probably damaging	Het
Gcnt2	CTAATG	C	13: 40,887,556		probably null	Het
Gm884	T	A	11: 103,615,812		probably benign	Het
Gramd1a	A	G	7: 31,132,756		probably null	Het
Gsn	T	A	2: 35,292,599	W187R	probably damaging	Het
Hoxc12	G	A	15: 102,938,360	G229D	probably damaging	Het
Ints14	T	C	9: 64,964,545	V55A	probably benign	Het
Itga9	T	C	9: 118,698,365	L528P	probably benign	Het
Klf1	C	T	8: 84,902,750	S68F	possibly damaging	Het
Krt39	A	C	11: 99,521,236	V8G	probably benign	Het
Krt71	A	G	15: 101,738,337	I312T	probably benign	Het
Lrp1b	T	C	2: 41,112,342	D2001G	possibly damaging	Het
Lrrc71	T	C	3: 87,748,386	T27A	probably benign	Het
Lrrcc1	T	C	3: 14,563,009	V958A	possibly damaging	Het
Med15	A	T	16: 17,698,155	M1K	probably null	Het
Mrgpra3	G	T	7: 47,590,090	N29K	possibly damaging	Het
Myl1	T	C	1: 66,930,236	N79S	probably damaging	Het
Naip2	A	T	13: 100,155,021	D1136E	probably benign	Het
Nat10	T	C	2: 103,754,108	N108S	probably benign	Het
Ncald	A	T	15: 37,368,878	S178T	probably benign	Het
Ndufs2	T	C	1: 171,238,308	D256G	probably benign	Het
Nek5	T	C	8: 22,107,723	N280S	probably benign	Het
Olfr1167	T	A	2: 88,149,125	D298V	probably damaging	Het
Olfr995	A	G	2: 85,438,430	S243P	probably damaging	Het
Parp1	G	T	1: 180,598,252	K849N	possibly damaging	Het
Pcdhb4	T	A	18: 37,308,782	C382S	possibly damaging	Het
Plce1	A	G	19: 38,739,357	N1520S	probably damaging	Het
Plcg2	G	A	8: 117,596,306	R700H	probably benign	Het
Popdc2	A	T	16: 38,362,811	Y52F	probably damaging	Het
Prrx1	T	A	1: 163,248,338	M220L	probably benign	Het
Pspc1	A	C	14: 56,758,628		probably null	Het
Ptchd1	T	A	X: 155,574,712	Y499F	probably damaging	Het
Ptpn20	A	G	14: 33,614,435	*44W	probably null	Het
Qars	T	A	9: 108,514,777	V83E	probably damaging	Het
Rrh	T	C	3: 129,815,693	E55G	possibly damaging	Het
Sash1	C	A	10: 8,730,083	E848*	probably null	Het
Sds	A	T	5: 120,480,847	K125M	possibly damaging	Het
Serpinf2	A	T	11: 75,438,418		probably benign	Het
Sh2b2	G	A	5: 136,218,885	T604I	probably benign	Het
Smug1	A	G	15: 103,155,942	L184P	probably damaging	Het
Spatc1	A	G	15: 76,283,880	T180A	probably benign	Het
Ssr1	A	T	13: 37,994,025	L20Q	probably null	Het
Supt4a	A	G	11: 87,743,258	E100G	probably damaging	Het
Tbx1	G	T	16: 18,586,801	P38T	unknown	Het
Tcl1	T	C	12: 105,217,601		probably benign	Het
Teddm2	T	C	1: 153,850,574	I132V	probably benign	Het
Tmem131	C	T	1: 36,792,973	G1861E	possibly damaging	Het
Tpr	A	T	1: 150,423,607	H1186L	probably benign	Het
Trim34b	A	T	7: 104,329,536		probably benign	Het
Trpm2	T	C	10: 77,912,592	M1415V	probably benign	Het
Ttll12	A	G	15: 83,586,885	F264S	probably benign	Het
Vmn2r59	T	C	7: 42,046,220	E256G	probably benign	Het
Vmn2r93	A	T	17: 18,326,410	H848L	probably benign	Het
Wdr70	T	C	15: 7,884,374	D598G	possibly damaging	Het
Ybey	T	C	10: 76,468,363	S2G	possibly damaging	Het
Zfp346	A	T	13: 55,132,387	Q308L	probably benign	Het
Zfp872	C	T	9: 22,200,560	P445L	probably benign	Het

Other mutations in Kmt2e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00783:Kmt2e	APN	5	23492358	missense	probably damaging	0.99
IGL01330:Kmt2e	APN	5	23497948	missense	possibly damaging	0.95
IGL01457:Kmt2e	APN	5	23502019	missense	possibly damaging	0.62
IGL01691:Kmt2e	APN	5	23497091	missense	probably benign
IGL02274:Kmt2e	APN	5	23500760	missense	probably benign	0.00
IGL02934:Kmt2e	APN	5	23497884	missense	probably damaging	0.97
IGL02964:Kmt2e	APN	5	23467100	splice site	probably benign
IGL03011:Kmt2e	APN	5	23497542	missense	probably damaging	1.00
IGL03291:Kmt2e	APN	5	23499291	missense	probably damaging	1.00
R0035:Kmt2e	UTSW	5	23485621	splice site	probably benign
R0446:Kmt2e	UTSW	5	23497534	splice site	probably null
R0498:Kmt2e	UTSW	5	23478972	nonsense	probably null
R0699:Kmt2e	UTSW	5	23473583	missense	probably benign	0.01
R0701:Kmt2e	UTSW	5	23473583	missense	probably benign	0.01
R0761:Kmt2e	UTSW	5	23503034	nonsense	probably null
R1110:Kmt2e	UTSW	5	23502655	missense	probably damaging	1.00
R1295:Kmt2e	UTSW	5	23502404	missense	probably damaging	0.99
R1432:Kmt2e	UTSW	5	23450321	missense	probably benign	0.39
R1495:Kmt2e	UTSW	5	23499327	missense	possibly damaging	0.83
R1505:Kmt2e	UTSW	5	23500535	missense	probably null	0.01
R1623:Kmt2e	UTSW	5	23482502	missense	probably damaging	1.00
R1675:Kmt2e	UTSW	5	23482453	nonsense	probably null
R1691:Kmt2e	UTSW	5	23464849	missense	probably damaging	1.00
R1778:Kmt2e	UTSW	5	23492364	missense	probably damaging	1.00
R1820:Kmt2e	UTSW	5	23473547	missense	probably damaging	1.00
R1846:Kmt2e	UTSW	5	23499486	intron	probably benign
R1912:Kmt2e	UTSW	5	23492395	missense	probably benign	0.07
R2070:Kmt2e	UTSW	5	23501995	missense	probably benign
R2195:Kmt2e	UTSW	5	23502196	unclassified	probably null
R2571:Kmt2e	UTSW	5	23501887	missense	probably benign	0.08
R3901:Kmt2e	UTSW	5	23501642	missense	probably benign	0.02
R3902:Kmt2e	UTSW	5	23501642	missense	probably benign	0.02
R3905:Kmt2e	UTSW	5	23501626	missense	probably benign	0.01
R3906:Kmt2e	UTSW	5	23501626	missense	probably benign	0.01
R3909:Kmt2e	UTSW	5	23501626	missense	probably benign	0.01
R3956:Kmt2e	UTSW	5	23496025	missense	probably benign	0.00
R4242:Kmt2e	UTSW	5	23502822	unclassified	probably benign
R4299:Kmt2e	UTSW	5	23464914	missense	probably damaging	1.00
R4448:Kmt2e	UTSW	5	23464790	missense	possibly damaging	0.80
R4528:Kmt2e	UTSW	5	23473558	missense	possibly damaging	0.69
R4574:Kmt2e	UTSW	5	23492407	missense	possibly damaging	0.60
R4719:Kmt2e	UTSW	5	23492315	missense	probably damaging	1.00
R4754:Kmt2e	UTSW	5	23482441	missense	possibly damaging	0.88
R4787:Kmt2e	UTSW	5	23463083	missense	possibly damaging	0.65
R4812:Kmt2e	UTSW	5	23502587	missense	possibly damaging	0.86
R4853:Kmt2e	UTSW	5	23502341	missense	probably damaging	1.00
R5138:Kmt2e	UTSW	5	23502695	missense	probably damaging	0.99
R5306:Kmt2e	UTSW	5	23499333	missense	probably damaging	0.98
R5659:Kmt2e	UTSW	5	23497807	missense	probably damaging	0.99
R5907:Kmt2e	UTSW	5	23464706	missense	probably damaging	1.00
R5920:Kmt2e	UTSW	5	23499442	missense	possibly damaging	0.50
R6280:Kmt2e	UTSW	5	23499516	missense	possibly damaging	0.48
R6353:Kmt2e	UTSW	5	23493245	missense	probably damaging	1.00
R6375:Kmt2e	UTSW	5	23499519	missense	probably benign
R6553:Kmt2e	UTSW	5	23463026	missense	probably damaging	0.99
R6572:Kmt2e	UTSW	5	23497581	missense	possibly damaging	0.66
R6678:Kmt2e	UTSW	5	23499295	missense	possibly damaging	0.54
R6791:Kmt2e	UTSW	5	23499476	intron	probably benign
R6792:Kmt2e	UTSW	5	23499476	intron	probably benign
R6794:Kmt2e	UTSW	5	23499476	intron	probably benign
R6797:Kmt2e	UTSW	5	23482507	missense	possibly damaging	0.82
R6947:Kmt2e	UTSW	5	23497545	missense	probably damaging	1.00
R7023:Kmt2e	UTSW	5	23500487	missense	possibly damaging	0.46
R7173:Kmt2e	UTSW	5	23464857	missense	probably damaging	1.00
R7202:Kmt2e	UTSW	5	23492294	unclassified	probably benign
R7563:Kmt2e	UTSW	5	23500273	missense	probably damaging	1.00
R7571:Kmt2e	UTSW	5	23478587	missense	probably damaging	1.00
R7604:Kmt2e	UTSW	5	23501765	missense	not run
R7722:Kmt2e	UTSW	5	23497018	missense	probably benign	0.00
R7758:Kmt2e	UTSW	5	23496070	missense	possibly damaging	0.92
R7794:Kmt2e	UTSW	5	23464716	missense	probably damaging	1.00
RF019:Kmt2e	UTSW	5	23499494	intron	probably benign
RF026:Kmt2e	UTSW	5	23478509	critical splice acceptor site	probably benign
RF028:Kmt2e	UTSW	5	23478509	critical splice acceptor site	probably benign
RF040:Kmt2e	UTSW	5	23478509	critical splice acceptor site	probably benign
RF042:Kmt2e	UTSW	5	23478509	critical splice acceptor site	probably benign
Z1177:Kmt2e	UTSW	5	23481208	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGCACCAGAAATTGATCCTTCATCTG -3'
(R):5'- TGATAAGTGCATCAGGAGGC -3'

Sequencing Primer
(F):5'- TTTGGGAAACAAAAATCAAAGCATG -3'
(R):5'- GCATCAGGAGGCAAGTCTTTG -3'

Posted On

2019-05-13