Incidental Mutation 'R7036:Kmt2e'
ID546672
Institutional Source Beutler Lab
Gene Symbol Kmt2e
Ensembl Gene ENSMUSG00000029004
Gene Namelysine (K)-specific methyltransferase 2E
SynonymsD230038D11Rik, 9530077A04Rik, 1810033J14Rik, Mll5
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7036 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location23434441-23504235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23478743 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 333 (E333G)
Ref Sequence ENSEMBL: ENSMUSP00000110781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094962] [ENSMUST00000115128] [ENSMUST00000196889]
Predicted Effect probably null
Transcript: ENSMUST00000094962
AA Change: E333G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092569
Gene: ENSMUSG00000029004
AA Change: E333G

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 4.25e-8 SMART
SET 328 453 2.13e-26 SMART
low complexity region 487 503 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 854 867 N/A INTRINSIC
low complexity region 882 908 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
low complexity region 951 960 N/A INTRINSIC
low complexity region 1184 1197 N/A INTRINSIC
low complexity region 1214 1237 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1348 1367 N/A INTRINSIC
internal_repeat_1 1434 1496 6.13e-7 PROSPERO
low complexity region 1506 1518 N/A INTRINSIC
low complexity region 1625 1641 N/A INTRINSIC
low complexity region 1677 1705 N/A INTRINSIC
low complexity region 1720 1731 N/A INTRINSIC
internal_repeat_1 1783 1842 6.13e-7 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000115128
AA Change: E333G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110781
Gene: ENSMUSG00000029004
AA Change: E333G

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 4.25e-8 SMART
SET 328 453 2.13e-26 SMART
low complexity region 487 503 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 854 867 N/A INTRINSIC
low complexity region 882 908 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
low complexity region 951 960 N/A INTRINSIC
low complexity region 1184 1197 N/A INTRINSIC
low complexity region 1214 1237 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1348 1367 N/A INTRINSIC
internal_repeat_1 1434 1496 6.13e-7 PROSPERO
low complexity region 1506 1518 N/A INTRINSIC
low complexity region 1625 1641 N/A INTRINSIC
low complexity region 1677 1705 N/A INTRINSIC
low complexity region 1720 1731 N/A INTRINSIC
internal_repeat_1 1783 1842 6.13e-7 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000196889
AA Change: E333G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142568
Gene: ENSMUSG00000029004
AA Change: E333G

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 2.7e-10 SMART
Blast:SET 216 327 6e-61 BLAST
Blast:SET 328 377 3e-26 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a protein with an N-terminal PHD zinc finger and a central SET domain. Overexpression of the protein inhibits cell cycle progression. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal and postnatal lethality, reduced fertility and growth, and abnormal lymphopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,609,256 probably null Het
9030624J02Rik T C 7: 118,773,092 S290P probably damaging Het
9130011E15Rik A G 19: 45,965,249 I195T probably damaging Het
Ahnak2 A G 12: 112,778,781 probably benign Het
Akt2 T C 7: 27,637,012 probably null Het
Aldh1a7 A T 19: 20,708,178 L336Q possibly damaging Het
Ank2 T C 3: 126,946,392 probably benign Het
Ank3 C T 10: 69,999,379 T680M probably damaging Het
Apeh T C 9: 108,094,271 E59G possibly damaging Het
Arl8a G C 1: 135,154,468 E145Q probably benign Het
Armc8 C T 9: 99,483,965 probably null Het
Arsj T C 3: 126,365,000 L76P probably damaging Het
Atp2b1 C T 10: 98,987,310 T244I probably damaging Het
Bcl6 A T 16: 23,974,861 L112Q probably damaging Het
Bfsp1 T A 2: 143,826,923 T579S possibly damaging Het
Btaf1 C A 19: 37,004,469 T1633K probably benign Het
Cacng8 A G 7: 3,415,303 S324G probably benign Het
Cd2ap A T 17: 42,798,599 L623Q probably damaging Het
Cerkl T C 2: 79,341,378 I379V probably benign Het
Cndp2 T A 18: 84,669,945 H307L possibly damaging Het
Derl1 A G 15: 57,879,047 probably null Het
Dixdc1 T A 9: 50,682,564 R254S probably benign Het
Dopey2 T A 16: 93,777,490 D30E probably benign Het
Duox2 T G 2: 122,280,453 H1513P probably damaging Het
Dyrk1a G A 16: 94,686,568 V546I probably benign Het
E130308A19Rik A C 4: 59,719,991 K508Q probably damaging Het
Emc8 A T 8: 120,659,051 V108E probably benign Het
Epb41l1 A G 2: 156,529,402 T720A probably benign Het
Fam126b T A 1: 58,535,537 M282L probably benign Het
Fam71b G A 11: 46,407,408 S513N Het
Fcgr4 T A 1: 171,020,088 M85K probably benign Het
Fem1b T A 9: 62,797,028 I317F probably damaging Het
Focad A G 4: 88,124,637 E36G probably benign Het
Fryl C T 5: 73,055,608 E2275K probably benign Het
Galnt11 T C 5: 25,258,813 I361T probably damaging Het
Gatad2a A T 8: 69,917,994 N114K probably damaging Het
Gcnt2 CTAATG C 13: 40,887,556 probably null Het
Gm884 T A 11: 103,615,812 probably benign Het
Gramd1a A G 7: 31,132,756 probably null Het
Gsn T A 2: 35,292,599 W187R probably damaging Het
Hoxc12 G A 15: 102,938,360 G229D probably damaging Het
Ints14 T C 9: 64,964,545 V55A probably benign Het
Itga9 T C 9: 118,698,365 L528P probably benign Het
Klf1 C T 8: 84,902,750 S68F possibly damaging Het
Krt39 A C 11: 99,521,236 V8G probably benign Het
Krt71 A G 15: 101,738,337 I312T probably benign Het
Lrp1b T C 2: 41,112,342 D2001G possibly damaging Het
Lrrc71 T C 3: 87,748,386 T27A probably benign Het
Lrrcc1 T C 3: 14,563,009 V958A possibly damaging Het
Med15 A T 16: 17,698,155 M1K probably null Het
Mrgpra3 G T 7: 47,590,090 N29K possibly damaging Het
Myl1 T C 1: 66,930,236 N79S probably damaging Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Nat10 T C 2: 103,754,108 N108S probably benign Het
Ncald A T 15: 37,368,878 S178T probably benign Het
Ndufs2 T C 1: 171,238,308 D256G probably benign Het
Nek5 T C 8: 22,107,723 N280S probably benign Het
Olfr1167 T A 2: 88,149,125 D298V probably damaging Het
Olfr995 A G 2: 85,438,430 S243P probably damaging Het
Parp1 G T 1: 180,598,252 K849N possibly damaging Het
Pcdhb4 T A 18: 37,308,782 C382S possibly damaging Het
Plce1 A G 19: 38,739,357 N1520S probably damaging Het
Plcg2 G A 8: 117,596,306 R700H probably benign Het
Popdc2 A T 16: 38,362,811 Y52F probably damaging Het
Prrx1 T A 1: 163,248,338 M220L probably benign Het
Pspc1 A C 14: 56,758,628 probably null Het
Ptchd1 T A X: 155,574,712 Y499F probably damaging Het
Ptpn20 A G 14: 33,614,435 *44W probably null Het
Qars T A 9: 108,514,777 V83E probably damaging Het
Rrh T C 3: 129,815,693 E55G possibly damaging Het
Sash1 C A 10: 8,730,083 E848* probably null Het
Sds A T 5: 120,480,847 K125M possibly damaging Het
Serpinf2 A T 11: 75,438,418 probably benign Het
Sh2b2 G A 5: 136,218,885 T604I probably benign Het
Smug1 A G 15: 103,155,942 L184P probably damaging Het
Spatc1 A G 15: 76,283,880 T180A probably benign Het
Ssr1 A T 13: 37,994,025 L20Q probably null Het
Supt4a A G 11: 87,743,258 E100G probably damaging Het
Tbx1 G T 16: 18,586,801 P38T unknown Het
Tcl1 T C 12: 105,217,601 probably benign Het
Teddm2 T C 1: 153,850,574 I132V probably benign Het
Tmem131 C T 1: 36,792,973 G1861E possibly damaging Het
Tpr A T 1: 150,423,607 H1186L probably benign Het
Trim34b A T 7: 104,329,536 probably benign Het
Trpm2 T C 10: 77,912,592 M1415V probably benign Het
Ttll12 A G 15: 83,586,885 F264S probably benign Het
Vmn2r59 T C 7: 42,046,220 E256G probably benign Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Wdr70 T C 15: 7,884,374 D598G possibly damaging Het
Ybey T C 10: 76,468,363 S2G possibly damaging Het
Zfp346 A T 13: 55,132,387 Q308L probably benign Het
Zfp872 C T 9: 22,200,560 P445L probably benign Het
Other mutations in Kmt2e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Kmt2e APN 5 23492358 missense probably damaging 0.99
IGL01330:Kmt2e APN 5 23497948 missense possibly damaging 0.95
IGL01457:Kmt2e APN 5 23502019 missense possibly damaging 0.62
IGL01691:Kmt2e APN 5 23497091 missense probably benign
IGL02274:Kmt2e APN 5 23500760 missense probably benign 0.00
IGL02934:Kmt2e APN 5 23497884 missense probably damaging 0.97
IGL02964:Kmt2e APN 5 23467100 splice site probably benign
IGL03011:Kmt2e APN 5 23497542 missense probably damaging 1.00
IGL03291:Kmt2e APN 5 23499291 missense probably damaging 1.00
R0035:Kmt2e UTSW 5 23485621 splice site probably benign
R0446:Kmt2e UTSW 5 23497534 splice site probably null
R0498:Kmt2e UTSW 5 23478972 nonsense probably null
R0699:Kmt2e UTSW 5 23473583 missense probably benign 0.01
R0701:Kmt2e UTSW 5 23473583 missense probably benign 0.01
R0761:Kmt2e UTSW 5 23503034 nonsense probably null
R1110:Kmt2e UTSW 5 23502655 missense probably damaging 1.00
R1295:Kmt2e UTSW 5 23502404 missense probably damaging 0.99
R1432:Kmt2e UTSW 5 23450321 missense probably benign 0.39
R1495:Kmt2e UTSW 5 23499327 missense possibly damaging 0.83
R1505:Kmt2e UTSW 5 23500535 missense probably null 0.01
R1623:Kmt2e UTSW 5 23482502 missense probably damaging 1.00
R1675:Kmt2e UTSW 5 23482453 nonsense probably null
R1691:Kmt2e UTSW 5 23464849 missense probably damaging 1.00
R1778:Kmt2e UTSW 5 23492364 missense probably damaging 1.00
R1820:Kmt2e UTSW 5 23473547 missense probably damaging 1.00
R1846:Kmt2e UTSW 5 23499486 intron probably benign
R1912:Kmt2e UTSW 5 23492395 missense probably benign 0.07
R2070:Kmt2e UTSW 5 23501995 missense probably benign
R2195:Kmt2e UTSW 5 23502196 unclassified probably null
R2571:Kmt2e UTSW 5 23501887 missense probably benign 0.08
R3901:Kmt2e UTSW 5 23501642 missense probably benign 0.02
R3902:Kmt2e UTSW 5 23501642 missense probably benign 0.02
R3905:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3906:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3909:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3956:Kmt2e UTSW 5 23496025 missense probably benign 0.00
R4242:Kmt2e UTSW 5 23502822 unclassified probably benign
R4299:Kmt2e UTSW 5 23464914 missense probably damaging 1.00
R4448:Kmt2e UTSW 5 23464790 missense possibly damaging 0.80
R4528:Kmt2e UTSW 5 23473558 missense possibly damaging 0.69
R4574:Kmt2e UTSW 5 23492407 missense possibly damaging 0.60
R4719:Kmt2e UTSW 5 23492315 missense probably damaging 1.00
R4754:Kmt2e UTSW 5 23482441 missense possibly damaging 0.88
R4787:Kmt2e UTSW 5 23463083 missense possibly damaging 0.65
R4812:Kmt2e UTSW 5 23502587 missense possibly damaging 0.86
R4853:Kmt2e UTSW 5 23502341 missense probably damaging 1.00
R5138:Kmt2e UTSW 5 23502695 missense probably damaging 0.99
R5306:Kmt2e UTSW 5 23499333 missense probably damaging 0.98
R5659:Kmt2e UTSW 5 23497807 missense probably damaging 0.99
R5907:Kmt2e UTSW 5 23464706 missense probably damaging 1.00
R5920:Kmt2e UTSW 5 23499442 missense possibly damaging 0.50
R6280:Kmt2e UTSW 5 23499516 missense possibly damaging 0.48
R6353:Kmt2e UTSW 5 23493245 missense probably damaging 1.00
R6375:Kmt2e UTSW 5 23499519 missense probably benign
R6553:Kmt2e UTSW 5 23463026 missense probably damaging 0.99
R6572:Kmt2e UTSW 5 23497581 missense possibly damaging 0.66
R6678:Kmt2e UTSW 5 23499295 missense possibly damaging 0.54
R6791:Kmt2e UTSW 5 23499476 intron probably benign
R6792:Kmt2e UTSW 5 23499476 intron probably benign
R6794:Kmt2e UTSW 5 23499476 intron probably benign
R6797:Kmt2e UTSW 5 23482507 missense possibly damaging 0.82
R6947:Kmt2e UTSW 5 23497545 missense probably damaging 1.00
R7023:Kmt2e UTSW 5 23500487 missense possibly damaging 0.46
R7173:Kmt2e UTSW 5 23464857 missense probably damaging 1.00
R7202:Kmt2e UTSW 5 23492294 unclassified probably benign
R7563:Kmt2e UTSW 5 23500273 missense probably damaging 1.00
R7571:Kmt2e UTSW 5 23478587 missense probably damaging 1.00
R7604:Kmt2e UTSW 5 23501765 missense not run
R7722:Kmt2e UTSW 5 23497018 missense probably benign 0.00
R7758:Kmt2e UTSW 5 23496070 missense possibly damaging 0.92
R7794:Kmt2e UTSW 5 23464716 missense probably damaging 1.00
RF019:Kmt2e UTSW 5 23499494 intron probably benign
RF026:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF028:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF040:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF042:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
Z1177:Kmt2e UTSW 5 23481208 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGCACCAGAAATTGATCCTTCATCTG -3'
(R):5'- TGATAAGTGCATCAGGAGGC -3'

Sequencing Primer
(F):5'- TTTGGGAAACAAAAATCAAAGCATG -3'
(R):5'- GCATCAGGAGGCAAGTCTTTG -3'
Posted On2019-05-13