Incidental Mutation 'R7036:Gramd1a'
ID546679
Institutional Source Beutler Lab
Gene Symbol Gramd1a
Ensembl Gene ENSMUSG00000001248
Gene NameGRAM domain containing 1A
SynonymsD7Bwg0611e, 1300003M23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R7036 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location31130127-31155896 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 31132756 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000001280] [ENSMUST00000085636] [ENSMUST00000186634]
Predicted Effect probably null
Transcript: ENSMUST00000001280
SMART Domains Protein: ENSMUSP00000001280
Gene: ENSMUSG00000001248

DomainStartEndE-ValueType
low complexity region 8 39 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
GRAM 93 160 2.54e-29 SMART
low complexity region 342 360 N/A INTRINSIC
Pfam:DUF4782 372 520 7.3e-37 PFAM
low complexity region 531 542 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
transmembrane domain 606 628 N/A INTRINSIC
low complexity region 707 719 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000085636
SMART Domains Protein: ENSMUSP00000082778
Gene: ENSMUSG00000001248

DomainStartEndE-ValueType
low complexity region 8 39 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
GRAM 93 160 2.54e-29 SMART
low complexity region 342 360 N/A INTRINSIC
Pfam:DUF4782 372 500 1.1e-28 PFAM
low complexity region 514 528 N/A INTRINSIC
transmembrane domain 572 594 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186634
SMART Domains Protein: ENSMUSP00000140195
Gene: ENSMUSG00000001248

DomainStartEndE-ValueType
low complexity region 8 39 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
GRAM 93 160 8.9e-32 SMART
low complexity region 342 360 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000202814
Predicted Effect probably benign
Transcript: ENSMUST00000206233
Predicted Effect probably benign
Transcript: ENSMUST00000206432
Predicted Effect probably null
Transcript: ENSMUST00000220635
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,609,256 probably null Het
9030624J02Rik T C 7: 118,773,092 S290P probably damaging Het
9130011E15Rik A G 19: 45,965,249 I195T probably damaging Het
Ahnak2 A G 12: 112,778,781 probably benign Het
Akt2 T C 7: 27,637,012 probably null Het
Aldh1a7 A T 19: 20,708,178 L336Q possibly damaging Het
Ank2 T C 3: 126,946,392 probably benign Het
Ank3 C T 10: 69,999,379 T680M probably damaging Het
Apeh T C 9: 108,094,271 E59G possibly damaging Het
Arl8a G C 1: 135,154,468 E145Q probably benign Het
Armc8 C T 9: 99,483,965 probably null Het
Arsj T C 3: 126,365,000 L76P probably damaging Het
Atp2b1 C T 10: 98,987,310 T244I probably damaging Het
Bcl6 A T 16: 23,974,861 L112Q probably damaging Het
Bfsp1 T A 2: 143,826,923 T579S possibly damaging Het
Btaf1 C A 19: 37,004,469 T1633K probably benign Het
Cacng8 A G 7: 3,415,303 S324G probably benign Het
Cd2ap A T 17: 42,798,599 L623Q probably damaging Het
Cerkl T C 2: 79,341,378 I379V probably benign Het
Cndp2 T A 18: 84,669,945 H307L possibly damaging Het
Derl1 A G 15: 57,879,047 probably null Het
Dixdc1 T A 9: 50,682,564 R254S probably benign Het
Dopey2 T A 16: 93,777,490 D30E probably benign Het
Duox2 T G 2: 122,280,453 H1513P probably damaging Het
Dyrk1a G A 16: 94,686,568 V546I probably benign Het
E130308A19Rik A C 4: 59,719,991 K508Q probably damaging Het
Emc8 A T 8: 120,659,051 V108E probably benign Het
Epb41l1 A G 2: 156,529,402 T720A probably benign Het
Fam126b T A 1: 58,535,537 M282L probably benign Het
Fam71b G A 11: 46,407,408 S513N Het
Fcgr4 T A 1: 171,020,088 M85K probably benign Het
Fem1b T A 9: 62,797,028 I317F probably damaging Het
Focad A G 4: 88,124,637 E36G probably benign Het
Fryl C T 5: 73,055,608 E2275K probably benign Het
Galnt11 T C 5: 25,258,813 I361T probably damaging Het
Gatad2a A T 8: 69,917,994 N114K probably damaging Het
Gcnt2 CTAATG C 13: 40,887,556 probably null Het
Gm884 T A 11: 103,615,812 probably benign Het
Gsn T A 2: 35,292,599 W187R probably damaging Het
Hoxc12 G A 15: 102,938,360 G229D probably damaging Het
Ints14 T C 9: 64,964,545 V55A probably benign Het
Itga9 T C 9: 118,698,365 L528P probably benign Het
Klf1 C T 8: 84,902,750 S68F possibly damaging Het
Kmt2e A G 5: 23,478,743 E333G probably null Het
Krt39 A C 11: 99,521,236 V8G probably benign Het
Krt71 A G 15: 101,738,337 I312T probably benign Het
Lrp1b T C 2: 41,112,342 D2001G possibly damaging Het
Lrrc71 T C 3: 87,748,386 T27A probably benign Het
Lrrcc1 T C 3: 14,563,009 V958A possibly damaging Het
Med15 A T 16: 17,698,155 M1K probably null Het
Mrgpra3 G T 7: 47,590,090 N29K possibly damaging Het
Myl1 T C 1: 66,930,236 N79S probably damaging Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Nat10 T C 2: 103,754,108 N108S probably benign Het
Ncald A T 15: 37,368,878 S178T probably benign Het
Ndufs2 T C 1: 171,238,308 D256G probably benign Het
Nek5 T C 8: 22,107,723 N280S probably benign Het
Olfr1167 T A 2: 88,149,125 D298V probably damaging Het
Olfr995 A G 2: 85,438,430 S243P probably damaging Het
Parp1 G T 1: 180,598,252 K849N possibly damaging Het
Pcdhb4 T A 18: 37,308,782 C382S possibly damaging Het
Plce1 A G 19: 38,739,357 N1520S probably damaging Het
Plcg2 G A 8: 117,596,306 R700H probably benign Het
Popdc2 A T 16: 38,362,811 Y52F probably damaging Het
Prrx1 T A 1: 163,248,338 M220L probably benign Het
Pspc1 A C 14: 56,758,628 probably null Het
Ptchd1 T A X: 155,574,712 Y499F probably damaging Het
Ptpn20 A G 14: 33,614,435 *44W probably null Het
Qars T A 9: 108,514,777 V83E probably damaging Het
Rrh T C 3: 129,815,693 E55G possibly damaging Het
Sash1 C A 10: 8,730,083 E848* probably null Het
Sds A T 5: 120,480,847 K125M possibly damaging Het
Serpinf2 A T 11: 75,438,418 probably benign Het
Sh2b2 G A 5: 136,218,885 T604I probably benign Het
Smug1 A G 15: 103,155,942 L184P probably damaging Het
Spatc1 A G 15: 76,283,880 T180A probably benign Het
Ssr1 A T 13: 37,994,025 L20Q probably null Het
Supt4a A G 11: 87,743,258 E100G probably damaging Het
Tbx1 G T 16: 18,586,801 P38T unknown Het
Tcl1 T C 12: 105,217,601 probably benign Het
Teddm2 T C 1: 153,850,574 I132V probably benign Het
Tmem131 C T 1: 36,792,973 G1861E possibly damaging Het
Tpr A T 1: 150,423,607 H1186L probably benign Het
Trim34b A T 7: 104,329,536 probably benign Het
Trpm2 T C 10: 77,912,592 M1415V probably benign Het
Ttll12 A G 15: 83,586,885 F264S probably benign Het
Vmn2r59 T C 7: 42,046,220 E256G probably benign Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Wdr70 T C 15: 7,884,374 D598G possibly damaging Het
Ybey T C 10: 76,468,363 S2G possibly damaging Het
Zfp346 A T 13: 55,132,387 Q308L probably benign Het
Zfp872 C T 9: 22,200,560 P445L probably benign Het
Other mutations in Gramd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Gramd1a APN 7 31142568 missense probably damaging 0.99
IGL01627:Gramd1a APN 7 31139796 missense probably damaging 0.99
IGL01684:Gramd1a APN 7 31138905 missense possibly damaging 0.67
IGL01793:Gramd1a APN 7 31134413 critical splice donor site probably null
IGL01986:Gramd1a APN 7 31134009 missense possibly damaging 0.58
IGL02029:Gramd1a APN 7 31132824 missense possibly damaging 0.95
IGL02060:Gramd1a APN 7 31130571 nonsense probably null
IGL02569:Gramd1a APN 7 31130507 unclassified probably benign
IGL02606:Gramd1a APN 7 31134515 missense probably damaging 1.00
IGL02715:Gramd1a APN 7 31135854 missense probably damaging 1.00
IGL03253:Gramd1a APN 7 31139846 nonsense probably null
PIT4377001:Gramd1a UTSW 7 31143670 missense possibly damaging 0.95
PIT4618001:Gramd1a UTSW 7 31132596 missense probably benign 0.00
R0179:Gramd1a UTSW 7 31142418 missense probably damaging 1.00
R0329:Gramd1a UTSW 7 31138254 missense possibly damaging 0.93
R0330:Gramd1a UTSW 7 31138254 missense possibly damaging 0.93
R0628:Gramd1a UTSW 7 31142624 missense probably damaging 1.00
R0834:Gramd1a UTSW 7 31138164 missense possibly damaging 0.94
R1421:Gramd1a UTSW 7 31142866 missense probably damaging 0.98
R1430:Gramd1a UTSW 7 31132786 missense probably damaging 0.97
R1682:Gramd1a UTSW 7 31142900 splice site probably null
R1703:Gramd1a UTSW 7 31139534 missense possibly damaging 0.96
R1822:Gramd1a UTSW 7 31142573 missense probably damaging 1.00
R2308:Gramd1a UTSW 7 31139790 missense probably damaging 0.97
R3861:Gramd1a UTSW 7 31135940 missense possibly damaging 0.90
R4184:Gramd1a UTSW 7 31132515 intron probably benign
R4908:Gramd1a UTSW 7 31138867 missense probably benign 0.27
R4978:Gramd1a UTSW 7 31132788 missense possibly damaging 0.74
R5723:Gramd1a UTSW 7 31134483 missense probably damaging 1.00
R5927:Gramd1a UTSW 7 31139821 missense probably benign 0.33
R6466:Gramd1a UTSW 7 31143796 missense probably benign
R6838:Gramd1a UTSW 7 31134504 missense probably benign 0.30
R7034:Gramd1a UTSW 7 31132756 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACCTCAACGCTGTGGAAGTG -3'
(R):5'- TATGGCCAGCAAGCATGTAGG -3'

Sequencing Primer
(F):5'- TGCTTCTGCAGAGCCAAGATC -3'
(R):5'- GCTGTGTGACCCTAGGCATATC -3'
Posted On2019-05-13